Specific Information of Small Protein : SPROHSA150858
General Information
Small Protein ID | SPROHSA150858 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | MRMNLKKENWYSKRMVRSMLR* |
RNA Sequence | ATGAGAATGAATCTGAAAAAAGAGAACTGGTATTCAAAGAGGATGGTCAGGAGTATGCTCAGGTAA |
Protein Length | 21 |
Start Codon | ATG |
Location | chrX:20135826-20138589:- |
Blocks | 20135826-20135841,20138538-20138589 |
Mean PhyloCSF | -8.4921363267 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000173674; EIF1AX; ENSG00000201882; RF00493; ENSG00000201592; RF00494; NONHSAG054127;NONHSAG103304; |
Mass (Da) | mono. 2756.4; avg. 2758.4 |
Ribosome profiling
Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
---|
GSE45833_3 | ENSG00000173674.11 | ENST00000379607.10 | EIF1AX | Protein_coding | Internal | 0.002947 | None | 247 | 313 | 15 | 80.7948663 |
GSE45833_1 | ENSG00000173674.11 | ENST00000379607.10 | EIF1AX | Protein_coding | Internal | 0.023822 | None | 247 | 313 | 21 | 49.7252481 |
SRR964946_alt | ENSG00000173674.11 | ENST00000379607.10 | EIF1AX | Protein_coding | Internal | 0.048431 | 0.030242 | 247 | 313 | NA | NA |
Min Ribo P value | 0.002947 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE45833_1 | BJ cells | Proliferation | GSM1047584; GSM1047585 | 23594524; |
GSE45833_3 | BJ cells | Pre-senescence | GSM1047588 | 23594524; |
SRR964946_alt | HEK293 | WT | SRR964946 | 22927429; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |      |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
No results |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
No results |
Related Small Proteins with Different TISs