Specific Information of Small Protein : SPROHSA144114
General Information
| Small Protein ID | SPROHSA144114 |
| Organism | Human (Homo sapiens) |
| Small Protein Sequence | MNLKKENWYSKRMVRSMLR* |
| RNA Sequence | ATGAATCTGAAAAAAGAGAACTGGTATTCAAAGAGGATGGTCAGGAGTATGCTCAGGTAA |
| Protein Length | 19 |
| Start Codon | ATG |
| Location | chrX:20135826-20138583:- |
| Blocks | 20135826-20135841,20138538-20138583 |
| Mean PhyloCSF | -8.44264995257 |
| Data Source | Ribosome profiling; |
| Related Genes | ENSG00000173674; EIF1AX; ENSG00000201882; RF00493; ENSG00000201592; RF00494; NONHSAG054127;NONHSAG103304; |
| Mass (Da) | mono. 2469.3; avg. 2471 |
Ribosome profiling
| Min Ribo P value | 0.037141 |
| Min TIS P value | None |
| Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
|---|
| GSE45833_6 | BJ cells | Transformed | GSM1047591 | 23594524; |
Mass Spectrometry Information
Function and Disease
| Functional domain prediction |       |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|
| No results |
| Disease | Detected |
|---|
| No results |
Related Variants
| Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
|---|
| No results |
Related Small Proteins with Different TISs