SmProt

Specific Information of Small Protein : SPROMMU84561

General Information

Small Protein ID	SPROMMU84561
Organism	Mouse (Mus musculus)
Small Protein Sequence	MKILQGRILAGKLQRTPSADVLKTSESRN*
RNA Sequence	ATGAAGATTCTTCAAGGCAGAATCCTTGCAGGGAAGCTTCAAAGGACTCCATCTGCAGATGTTCTGAAAACCTCTGAGTCTAGAAATTGA
Protein Length	29
Start Codon	ATG
Location	chr1:12728644-12786124:+
Blocks	12728644-12728688,12786078-12786124
Mean PhyloCSF	-5.47673330837
Data Source	Ribosome profiling;
Related Genes	ENSMUSG00000016918; Sulf1; NONMMUG000117;
Mass (Da)	mono. 3209.8; avg. 3211.7

Ribosome profiling

Ribo-seq ID	Ensembl Gene ID	Ensembl Transcript ID	Symbol	Gene Type	TIS Type	Ribo P value	TIS P value	Start On Trans	Stop On Trans	In-frame Count	Ribo-seq RPKM
GSE105147_3	ENSMUSG00000016918.15	ENSMUST00000189541.6	Sulf1	Protein_coding	5'UTR	0.033173	None	167	257	5	13.8147348
GSE60095	ENSMUSG00000016918.15	ENSMUST00000189541.6	Sulf1	Protein_coding	5'UTR	0.000669	None	167	257	269	102.054533
GSE106386	ENSMUSG00000016918.15	ENSMUST00000189541.6	Sulf1	Protein_coding	5'UTR	0.004032	None	167	257	20	120.216813
GSE50983	ENSMUSG00000016918.15	ENSMUST00000189541.6	Sulf1	Protein_coding	5'UTR	0.001173	None	167	257	16	28.5205006
GSE50983_alt	ENSMUSG00000016918.15	ENSMUST00000189541.6	Sulf1	Protein_coding	5'UTR	0.001173	None	167	257	16	28.5205006
GSE51424	ENSMUSG00000016918.15	ENSMUST00000189541.6	Sulf1	Protein_coding	5'UTR	0.010725	None	167	257	6	6.93955639
GSE51424_alt	ENSMUSG00000016918.15	ENSMUST00000189541.6	Sulf1	Protein_coding	5'UTR	0.010725	None	167	257	6	6.93955639
GSE81283_1	ENSMUSG00000016918.15	ENSMUST00000189541.6	Sulf1	Protein_coding	5'UTR	0.033173	None	167	257	13	5.69151490
GSE81283_2	ENSMUSG00000016918.15	ENSMUST00000189541.6	Sulf1	Protein_coding	5'UTR	0.033173	None	167	257	5	11.1846321
GSE81283_2_alt	ENSMUSG00000016918.15	ENSMUST00000189541.6	Sulf1	Protein_coding	5'UTR	0.033173	None	167	257	5	11.1846321
GSE99585	ENSMUSG00000016918.15	ENSMUST00000189541.6	Sulf1	Protein_coding	5'UTR	0.005105	None	167	257	147	39.2632537
SRR618774,618775	ENSMUSG00000016918.15	ENSMUST00000189541.6	Sulf1	Protein_coding	5'UTR	0.01521	0.001267	167	257	6	43.8791926
GSE89011	ENSMUSG00000016918.15	ENSMUST00000189541.6	Sulf1	Protein_coding	5'UTR	0.005195	None	167	257	145	72.1719629
GSE105147_3	ENSMUSG00000016918.15	ENSMUST00000186051.6	Sulf1	Protein_coding	5'UTR	0.033173	None	204	294	5	13.8147348
GSE60095	ENSMUSG00000016918.15	ENSMUST00000186051.6	Sulf1	Protein_coding	5'UTR	0.000669	None	204	294	269	102.054533
GSE106386	ENSMUSG00000016918.15	ENSMUST00000186051.6	Sulf1	Protein_coding	5'UTR	0.004032	None	204	294	20	120.216813
GSE50983	ENSMUSG00000016918.15	ENSMUST00000186051.6	Sulf1	Protein_coding	5'UTR	0.001173	None	204	294	16	28.5205006
GSE50983_alt	ENSMUSG00000016918.15	ENSMUST00000186051.6	Sulf1	Protein_coding	5'UTR	0.001173	None	204	294	16	28.5205006
GSE51424	ENSMUSG00000016918.15	ENSMUST00000186051.6	Sulf1	Protein_coding	5'UTR	0.010725	None	204	294	6	6.93955639
GSE51424_alt	ENSMUSG00000016918.15	ENSMUST00000186051.6	Sulf1	Protein_coding	5'UTR	0.010725	None	204	294	6	6.93955639
GSE81283_1	ENSMUSG00000016918.15	ENSMUST00000186051.6	Sulf1	Protein_coding	5'UTR	0.033173	None	204	294	13	5.69151490
GSE81283_2	ENSMUSG00000016918.15	ENSMUST00000186051.6	Sulf1	Protein_coding	5'UTR	0.033173	None	204	294	5	11.1846321
GSE81283_2_alt	ENSMUSG00000016918.15	ENSMUST00000186051.6	Sulf1	Protein_coding	5'UTR	0.033173	None	204	294	5	11.1846321
GSE99585	ENSMUSG00000016918.15	ENSMUST00000186051.6	Sulf1	Protein_coding	5'UTR	0.005105	None	204	294	147	39.2632537
SRR618774,618775	ENSMUSG00000016918.15	ENSMUST00000186051.6	Sulf1	Protein_coding	5'UTR	0.01521	0.001267	204	294	6	43.8791926
GSE89011	ENSMUSG00000016918.15	ENSMUST00000186051.6	Sulf1	Protein_coding	5'UTR	0.005195	None	204	294	145	72.1719629
GSE105147_3	ENSMUSG00000016918.15	ENSMUST00000088585.9	Sulf1	Protein_coding	5'UTR	0.033173	None	306	396	5	13.8147348
GSE60095	ENSMUSG00000016918.15	ENSMUST00000088585.9	Sulf1	Protein_coding	5'UTR	0.000669	None	306	396	269	102.054533
GSE106386	ENSMUSG00000016918.15	ENSMUST00000088585.9	Sulf1	Protein_coding	5'UTR	0.004032	None	306	396	20	120.216813
GSE50983	ENSMUSG00000016918.15	ENSMUST00000088585.9	Sulf1	Protein_coding	5'UTR	0.001173	None	306	396	16	28.5205006
GSE50983_alt	ENSMUSG00000016918.15	ENSMUST00000088585.9	Sulf1	Protein_coding	5'UTR	0.001173	None	306	396	16	28.5205006
GSE51424	ENSMUSG00000016918.15	ENSMUST00000088585.9	Sulf1	Protein_coding	5'UTR	0.010725	None	306	396	6	6.93955639
GSE51424_alt	ENSMUSG00000016918.15	ENSMUST00000088585.9	Sulf1	Protein_coding	5'UTR	0.010725	None	306	396	6	6.93955639
GSE81283_1	ENSMUSG00000016918.15	ENSMUST00000088585.9	Sulf1	Protein_coding	5'UTR	0.033173	None	306	396	13	5.69151490
GSE81283_2	ENSMUSG00000016918.15	ENSMUST00000088585.9	Sulf1	Protein_coding	5'UTR	0.033173	None	306	396	5	11.1846321
GSE81283_2_alt	ENSMUSG00000016918.15	ENSMUST00000088585.9	Sulf1	Protein_coding	5'UTR	0.033173	None	306	396	5	11.1846321
GSE99585	ENSMUSG00000016918.15	ENSMUST00000088585.9	Sulf1	Protein_coding	5'UTR	0.005105	None	306	396	147	39.2632537
SRR618774,618775	ENSMUSG00000016918.15	ENSMUST00000088585.9	Sulf1	Protein_coding	5'UTR	0.01521	0.00018	306	396	6	43.8791926
GSE89011	ENSMUSG00000016918.15	ENSMUST00000088585.9	Sulf1	Protein_coding	5'UTR	0.005195	None	306	396	145	72.1719629
GSE105147_3	ENSMUSG00000016918.15	ENSMUST00000187376.6	Sulf1	Protein_coding	Novel	0.033173	None	376	466	5	13.8147348
GSE60095	ENSMUSG00000016918.15	ENSMUST00000187376.6	Sulf1	Protein_coding	Novel	0.000669	None	376	466	269	102.054533
GSE106386	ENSMUSG00000016918.15	ENSMUST00000187376.6	Sulf1	Protein_coding	Novel	0.004032	None	376	466	20	120.216813
GSE50983	ENSMUSG00000016918.15	ENSMUST00000187376.6	Sulf1	Protein_coding	Novel	0.001173	None	376	466	16	28.5205006
GSE50983_alt	ENSMUSG00000016918.15	ENSMUST00000187376.6	Sulf1	Protein_coding	Novel	0.001173	None	376	466	16	28.5205006
GSE51424	ENSMUSG00000016918.15	ENSMUST00000187376.6	Sulf1	Protein_coding	Novel	0.010725	None	376	466	6	6.93955639
GSE51424_alt	ENSMUSG00000016918.15	ENSMUST00000187376.6	Sulf1	Protein_coding	Novel	0.010725	None	376	466	6	6.93955639
GSE81283_1	ENSMUSG00000016918.15	ENSMUST00000187376.6	Sulf1	Protein_coding	Novel	0.033173	None	376	466	13	5.69151490
GSE81283_2	ENSMUSG00000016918.15	ENSMUST00000187376.6	Sulf1	Protein_coding	Novel	0.033173	None	376	466	5	11.1846321
GSE81283_2_alt	ENSMUSG00000016918.15	ENSMUST00000187376.6	Sulf1	Protein_coding	Novel	0.033173	None	376	466	5	11.1846321
GSE99585	ENSMUSG00000016918.15	ENSMUST00000187376.6	Sulf1	Protein_coding	Novel	0.005105	None	376	466	147	39.2632537
SRR618774,618775	ENSMUSG00000016918.15	ENSMUST00000187376.6	Sulf1	Protein_coding	Novel	0.01521	0.00018	376	466	6	43.8791926
GSE89011	ENSMUSG00000016918.15	ENSMUST00000187376.6	Sulf1	Protein_coding	Novel	0.005195	None	376	466	145	72.1719629
GSE105147_3	ENSMUSG00000016918.15	ENSMUST00000177608.7	Sulf1	Protein_coding	5'UTR	0.033173	None	459	549	5	13.8147348
GSE60095	ENSMUSG00000016918.15	ENSMUST00000177608.7	Sulf1	Protein_coding	5'UTR	0.000669	None	459	549	269	102.054533
GSE106386	ENSMUSG00000016918.15	ENSMUST00000177608.7	Sulf1	Protein_coding	5'UTR	0.004032	None	459	549	20	120.216813
GSE50983	ENSMUSG00000016918.15	ENSMUST00000177608.7	Sulf1	Protein_coding	5'UTR	0.001173	None	459	549	16	28.5205006
GSE50983_alt	ENSMUSG00000016918.15	ENSMUST00000177608.7	Sulf1	Protein_coding	5'UTR	0.001173	None	459	549	16	28.5205006
GSE51424	ENSMUSG00000016918.15	ENSMUST00000177608.7	Sulf1	Protein_coding	5'UTR	0.010725	None	459	549	6	6.93955639
GSE51424_alt	ENSMUSG00000016918.15	ENSMUST00000177608.7	Sulf1	Protein_coding	5'UTR	0.010725	None	459	549	6	6.93955639
GSE81283_1	ENSMUSG00000016918.15	ENSMUST00000177608.7	Sulf1	Protein_coding	5'UTR	0.033173	None	459	549	13	5.69151490
GSE81283_2	ENSMUSG00000016918.15	ENSMUST00000177608.7	Sulf1	Protein_coding	5'UTR	0.033173	None	459	549	5	11.1846321
GSE81283_2_alt	ENSMUSG00000016918.15	ENSMUST00000177608.7	Sulf1	Protein_coding	5'UTR	0.033173	None	459	549	5	11.1846321
GSE99585	ENSMUSG00000016918.15	ENSMUST00000177608.7	Sulf1	Protein_coding	5'UTR	0.005105	None	459	549	147	39.2632537
SRR618774,618775	ENSMUSG00000016918.15	ENSMUST00000177608.7	Sulf1	Protein_coding	5'UTR	0.01521	0.001267	459	549	6	43.8791926
GSE89011	ENSMUSG00000016918.15	ENSMUST00000177608.7	Sulf1	Protein_coding	5'UTR	0.005195	None	459	549	145	72.1719629
GSE105147_3	ENSMUSG00000016918.15	ENSMUST00000186405.6	Sulf1	Protein_coding	5'UTR	0.033173	None	526	616	5	13.8147348
GSE60095	ENSMUSG00000016918.15	ENSMUST00000186405.6	Sulf1	Protein_coding	5'UTR	0.000669	None	526	616	269	102.054533
GSE106386	ENSMUSG00000016918.15	ENSMUST00000186405.6	Sulf1	Protein_coding	5'UTR	0.004032	None	526	616	20	120.216813
GSE50983	ENSMUSG00000016918.15	ENSMUST00000186405.6	Sulf1	Protein_coding	5'UTR	0.001173	None	526	616	16	28.5205006
GSE50983_alt	ENSMUSG00000016918.15	ENSMUST00000186405.6	Sulf1	Protein_coding	5'UTR	0.001173	None	526	616	16	28.5205006
GSE51424	ENSMUSG00000016918.15	ENSMUST00000186405.6	Sulf1	Protein_coding	5'UTR	0.010725	None	526	616	6	6.93955639
GSE51424_alt	ENSMUSG00000016918.15	ENSMUST00000186405.6	Sulf1	Protein_coding	5'UTR	0.010725	None	526	616	6	6.93955639
GSE81283_1	ENSMUSG00000016918.15	ENSMUST00000186405.6	Sulf1	Protein_coding	5'UTR	0.033173	None	526	616	13	5.69151490
GSE81283_2	ENSMUSG00000016918.15	ENSMUST00000186405.6	Sulf1	Protein_coding	5'UTR	0.033173	None	526	616	5	11.1846321
GSE81283_2_alt	ENSMUSG00000016918.15	ENSMUST00000186405.6	Sulf1	Protein_coding	5'UTR	0.033173	None	526	616	5	11.1846321
GSE99585	ENSMUSG00000016918.15	ENSMUST00000186405.6	Sulf1	Protein_coding	5'UTR	0.005105	None	526	616	147	39.2632537
SRR618774,618775	ENSMUSG00000016918.15	ENSMUST00000186405.6	Sulf1	Protein_coding	5'UTR	0.01521	0.00018	526	616	6	43.8791926
GSE89011	ENSMUSG00000016918.15	ENSMUST00000186405.6	Sulf1	Protein_coding	5'UTR	0.005195	None	526	616	145	72.1719629

Min Ribo P value	0.000669
Min TIS P value	None

Ribo-seq ID	Cell or Tissue	Phenotype	Ribo-seq Source Details	PMID
GSE105147_3	C57BL/6-specific expression of MYC(Tg); KRAS(G12D)	Liver tumour	GSM2823265; GSM2823266	30643286;
GSE106386	ES cell derived neurons E14Tg2A.4	WT	GSM2836997	30349096;
GSE50983	129SvJae-testis	WT	GSM1234248; GSM1234252	25063675;
GSE50983_alt	129SvJae-testis	WT	GSM1234248; GSM1234252	25063675;
GSE51424	brain	WT	GSM1245214; GSM1245215; GSM1245216	25122893;
GSE51424_alt	brain	WT	GSM1245214; GSM1245215; GSM1245216	25122893;
GSE60095	ES cell	WT	GSM1464901	25159147;
GSE81283_1	C57BL/6JRj-kidney	WT	GSM2149102; GSM2149103	28622766;
GSE81283_2	C57BL/6JRj-kidney	WT	GSM2149122	28622766;
GSE81283_2_alt	C57BL/6JRj-kidney	WT	GSM2149122	28622766;
GSE89011	RF8-embryonic stem cell	WT	GSM2357212; GSM2357214	28003464;
GSE99585	C57BL/6-Quadriceps muscle	WT	GSM2648077; GSM2648078	28615380;
SRR618774,618775	MEF	WT	SRR618774; SRR618775	22927429;

Database information

No results

Literature information

No results

Mass Spectrometry Information

No results

Function and Disease

Functional domain prediction

Analysis	Signature Accession	Signature Description	Start location	Stop location	Score	Status of the match	InterPro accession	InterPro description	GO	Pathways
No results

Related Small Proteins with Different TISs

SmProt ID	Small Protein Length	Start Codon	Strand	Blocks
SPROMMU155665	8	CTG	+	12786097-12786124
SPROMMU40313	15	AGG	+	12728686-12728688, 12786078-12786124
SPROMMU148130	27	ATT	+	12728650-12728688, 12786078-12786124
SPROMMU7570	28	AAG	+	12728647-12728688, 12786078-12786124
SPROMMU235601	33	TTG	+	12728632-12728688, 12786078-12786124
SPROMMU199390	35	GTG	+	12728626-12728688, 12786078-12786124
SPROMMU162258	45	CTG	+	12728596-12728688, 12786078-12786124
SPROMMU146126	59	ATT	+	12692645-12692684, 12728593-12728688, 12786078-12786124
SPROMMU230155	74	TTG	+	12692600-12692684, 12728593-12728688, 12786078-12786124

a reliable repository with comprehensive annotation of small proteins derived from ribosome profiling