SmProt

Specific Information of Small Protein : SPROMMU40313

General Information

Small Protein ID	SPROMMU40313
Organism	Mouse (Mus musculus)
Small Protein Sequence	RTPSADVLKTSESRN*
RNA Sequence	AGGACTCCATCTGCAGATGTTCTGAAAACCTCTGAGTCTAGAAATTGA
Protein Length	15
Start Codon	AGG
Location	chr1:12728686-12786124:+
Blocks	12728686-12728688,12786078-12786124
Mean PhyloCSF	-4.65212496618
Data Source	Ribosome profiling;
Related Genes	ENSMUSG00000016918; Sulf1; NONMMUG000117;
Mass (Da)	mono. 1659.9; avg. 1660.8

Ribosome profiling

Ribo-seq ID	Ensembl Gene ID	Ensembl Transcript ID	Symbol	Gene Type	TIS Type	Ribo P value	TIS P value	Start On Trans	Stop On Trans	In-frame Count	Ribo-seq RPKM
GSE105147_3_alt	ENSMUSG00000016918.15	ENSMUST00000189541.6	Sulf1	Protein_coding	5'UTR	0.029761	None	209	257	5	25.9026278
GSE105147_3_alt	ENSMUSG00000016918.15	ENSMUST00000186051.6	Sulf1	Protein_coding	5'UTR	0.029761	None	246	294	5	25.9026278
GSE105147_3_alt	ENSMUSG00000016918.15	ENSMUST00000177608.7	Sulf1	Protein_coding	5'UTR	0.029761	None	501	549	5	25.9026278
GSE105147_3_alt	ENSMUSG00000016918.15	ENSMUST00000186405.6	Sulf1	Protein_coding	5'UTR	0.029761	None	568	616	5	25.9026278

Min Ribo P value	0.029761
Min TIS P value	None

Ribo-seq ID	Cell or Tissue	Phenotype	Ribo-seq Source Details	PMID
GSE105147_3_alt	C57BL/6-specific expression of MYC(Tg); KRAS(G12D)	Liver tumour	GSM2823265; GSM2823266	30643286;

Database information

No results

Literature information

No results

Mass Spectrometry Information

No results

Function and Disease

Functional domain prediction

Analysis	Signature Accession	Signature Description	Start location	Stop location	Score	Status of the match	InterPro accession	InterPro description	GO	Pathways
No results

Related Small Proteins with Different TISs

SmProt ID	Small Protein Length	Start Codon	Strand	Blocks
SPROMMU155665	8	CTG	+	12786097-12786124
SPROMMU148130	27	ATT	+	12728650-12728688, 12786078-12786124
SPROMMU7570	28	AAG	+	12728647-12728688, 12786078-12786124
SPROMMU84561	29	ATG	+	12728644-12728688, 12786078-12786124
SPROMMU235601	33	TTG	+	12728632-12728688, 12786078-12786124
SPROMMU199390	35	GTG	+	12728626-12728688, 12786078-12786124
SPROMMU162258	45	CTG	+	12728596-12728688, 12786078-12786124
SPROMMU146126	59	ATT	+	12692645-12692684, 12728593-12728688, 12786078-12786124
SPROMMU230155	74	TTG	+	12692600-12692684, 12728593-12728688, 12786078-12786124
SPROMMU154261	26	ATT	+	12692649-12692684, 12786078-12786124