SmProt

Specific Information of Small Protein : SPROMMU7570

General Information

Small Protein ID	SPROMMU7570
Organism	Mouse (Mus musculus)
Small Protein Sequence	KILQGRILAGKLQRTPSADVLKTSESRN*
RNA Sequence	AAGATTCTTCAAGGCAGAATCCTTGCAGGGAAGCTTCAAAGGACTCCATCTGCAGATGTTCTGAAAACCTCTGAGTCTAGAAATTGA
Protein Length	28
Start Codon	AAG
Location	chr1:12728647-12786124:+
Blocks	12728647-12728688,12786078-12786124
Mean PhyloCSF	-5.51668963487
Data Source	Ribosome profiling;
Related Genes	ENSMUSG00000016918; Sulf1; NONMMUG000117;
Mass (Da)	mono. 3078.8; avg. 3080.5

Ribosome profiling

Ribo-seq ID	Ensembl Gene ID	Ensembl Transcript ID	Symbol	Gene Type	TIS Type	Ribo P value	TIS P value	Start On Trans	Stop On Trans	In-frame Count	Ribo-seq RPKM
GSE89011_alt	ENSMUSG00000016918.15	ENSMUST00000189541.6	Sulf1	Protein_coding	5'UTR	0.004801	None	170	257	88	45.3112918
GSE89011_alt	ENSMUSG00000016918.15	ENSMUST00000186051.6	Sulf1	Protein_coding	5'UTR	0.004801	None	207	294	88	45.3112918
GSE89011_alt	ENSMUSG00000016918.15	ENSMUST00000088585.9	Sulf1	Protein_coding	5'UTR	0.004801	None	309	396	88	45.3112918
GSE89011_alt	ENSMUSG00000016918.15	ENSMUST00000187376.6	Sulf1	Protein_coding	Novel	0.004801	None	379	466	88	45.3112918
GSE89011_alt	ENSMUSG00000016918.15	ENSMUST00000177608.7	Sulf1	Protein_coding	5'UTR	0.004801	None	462	549	88	45.3112918
GSE89011_alt	ENSMUSG00000016918.15	ENSMUST00000186405.6	Sulf1	Protein_coding	5'UTR	0.004801	None	529	616	88	45.3112918

Min Ribo P value	0.004801
Min TIS P value	None

Ribo-seq ID	Cell or Tissue	Phenotype	Ribo-seq Source Details	PMID
GSE89011_alt	RF8-embryonic stem cell	WT	GSM2357212; GSM2357214	28003464;

Database information

No results

Literature information

No results

Mass Spectrometry Information

No results

Function and Disease

Functional domain prediction

Analysis	Signature Accession	Signature Description	Start location	Stop location	Score	Status of the match	InterPro accession	InterPro description	GO	Pathways
No results

Related Small Proteins with Different TISs

SmProt ID	Small Protein Length	Start Codon	Strand	Blocks
SPROMMU155665	8	CTG	+	12786097-12786124
SPROMMU40313	15	AGG	+	12728686-12728688, 12786078-12786124
SPROMMU148130	27	ATT	+	12728650-12728688, 12786078-12786124
SPROMMU84561	29	ATG	+	12728644-12728688, 12786078-12786124
SPROMMU235601	33	TTG	+	12728632-12728688, 12786078-12786124
SPROMMU199390	35	GTG	+	12728626-12728688, 12786078-12786124
SPROMMU162258	45	CTG	+	12728596-12728688, 12786078-12786124
SPROMMU146126	59	ATT	+	12692645-12692684, 12728593-12728688, 12786078-12786124
SPROMMU230155	74	TTG	+	12692600-12692684, 12728593-12728688, 12786078-12786124