SmProt

Specific Information of Small Protein : SPROMMU155665

General Information

Small Protein ID	SPROMMU155665
Organism	Mouse (Mus musculus)
Small Protein Sequence	LKTSESRN*
RNA Sequence	CTGAAAACCTCTGAGTCTAGAAATTGA
Protein Length	8
Start Codon	CTG
Location	chr1:12786097-12786124:+
Blocks	12786097-12786124
Mean PhyloCSF	-5.34411107169
Data Source	Ribosome profiling;
Related Genes	ENSMUSG00000016918; Sulf1;
Mass (Da)	mono. 933.5; avg. 934

Ribosome profiling

Ribo-seq ID	Ensembl Gene ID	Ensembl Transcript ID	Symbol	Gene Type	TIS Type	Ribo P value	TIS P value	Start On Trans	Stop On Trans	In-frame Count	Ribo-seq RPKM
GSE60095_alt	ENSMUSG00000016918.15	ENSMUST00000186674.1	Sulf1	Protein_coding	Novel	0.019296	None	176	203	77	97.3754535
GSE99585_alt	ENSMUSG00000016918.15	ENSMUST00000186674.1	Sulf1	Protein_coding	Novel	0.041298	None	176	203	32	28.4903428
GSE89011_alt	ENSMUSG00000016918.15	ENSMUST00000186674.1	Sulf1	Protein_coding	Novel	0.035928	None	176	203	27	44.7963907
GSE60095_alt	ENSMUSG00000016918.15	ENSMUST00000180062.7	Sulf1	Protein_coding	5'UTR	0.019296	None	381	408	77	97.3754535
GSE99585_alt	ENSMUSG00000016918.15	ENSMUST00000180062.7	Sulf1	Protein_coding	5'UTR	0.041298	None	381	408	32	28.4903428

Min Ribo P value	0.019296
Min TIS P value	None

Ribo-seq ID	Cell or Tissue	Phenotype	Ribo-seq Source Details	PMID
GSE60095_alt	ES cell	WT	GSM1464901	25159147;
GSE89011_alt	RF8-embryonic stem cell	WT	GSM2357212; GSM2357214	28003464;
GSE99585_alt	C57BL/6-Quadriceps muscle	WT	GSM2648077; GSM2648078	28615380;

Database information

No results

Literature information

No results

Mass Spectrometry Information

No results

Function and Disease

Functional domain prediction

Analysis	Signature Accession	Signature Description	Start location	Stop location	Score	Status of the match	InterPro accession	InterPro description	GO	Pathways
No results

Related Small Proteins with Different TISs

SmProt ID	Small Protein Length	Start Codon	Strand	Blocks
SPROMMU40313	15	AGG	+	12728686-12728688, 12786078-12786124
SPROMMU148130	27	ATT	+	12728650-12728688, 12786078-12786124
SPROMMU7570	28	AAG	+	12728647-12728688, 12786078-12786124
SPROMMU84561	29	ATG	+	12728644-12728688, 12786078-12786124
SPROMMU235601	33	TTG	+	12728632-12728688, 12786078-12786124
SPROMMU199390	35	GTG	+	12728626-12728688, 12786078-12786124
SPROMMU162258	45	CTG	+	12728596-12728688, 12786078-12786124
SPROMMU146126	59	ATT	+	12692645-12692684, 12728593-12728688, 12786078-12786124
SPROMMU230155	74	TTG	+	12692600-12692684, 12728593-12728688, 12786078-12786124
SPROMMU154261	26	ATT	+	12692649-12692684, 12786078-12786124