SmProt

Specific Information of Small Protein : SPROHSA342233

General Information

Small Protein ID	SPROHSA342233
Organism	Human (Homo sapiens)
Small Protein Sequence	VDGAAHPASLVATLPG*
RNA Sequence	GTGGACGGCGCTGCTCATCCTGCAAGCCTTGTTGCTACCCTCCCTGGCTGA
Protein Length	16
Start Codon	GTG
Location	chr19:11577258-11577309:-
Blocks	11577258-11577309
Mean PhyloCSF	-7.65149016941
Data Source	Ribosome profiling;
Related Genes	ENSG00000198551; ZNF627; ENSG00000102575; ACP5;
Mass (Da)	mono. 1474.8; avg. 1475.6

Ribosome profiling

Ribo-seq ID	Ensembl Gene ID	Ensembl Transcript ID	Symbol	Gene Type	TIS Type	Ribo P value	TIS P value	Start On Trans	Stop On Trans	In-frame Count	Ribo-seq RPKM
SRR5512738_alt	ENSG00000102575.12	ENST00000588079.1	ACP5	Protein_coding	Novel	0.029504	None	116	167	10	24.8566442
SRR5512738_alt	ENSG00000102575.12	ENST00000590832.1	ACP5	Protein_coding	Internal	0.029504	None	218	269	10	24.8566442
SRR5512738_alt	ENSG00000102575.12	ENST00000648477.1	ACP5	Protein_coding	Internal	0.029504	None	61	112	10	24.8566442

Min Ribo P value	0.029504
Min TIS P value	None

Ribo-seq ID	Cell or Tissue	Phenotype	Ribo-seq Source Details	PMID
SRR5512738_alt	GM19147-Lymphoblastoid Cell Line	WT	GSM2601312	29950183;

Database information

No results

Literature information

No results

Mass Spectrometry Information

No results

Function and Disease

Functional domain prediction

Analysis	Signature Accession	Signature Description	Start location	Stop location	Score	Status of the match	InterPro accession	InterPro description	GO	Pathways
No results

Disease	Detected
No results

Related Variants

Variant ID	Consequence to sORF	rsID	Ribo-seq ID
No results

Related Small Proteins with Different TISs

SmProt ID	Small Protein Length	Start Codon	Strand	Blocks
SPROHSA178840	26	ATG	-	11577258-11577339
SPROHSA48485	59	ACG	-	11577258-11577317, 11577592-11577679, 11578023-11578057
SPROHSA174251	63	ATG	-	11577258-11577317, 11577592-11577679, 11578023-11578069
SPROHSA264935	60	CTG	-	11577258-11577317, 11577592-11577679, 11578075-11578112
SPROHSA54732	50	ACG	-	11577258-11577317, 11577592-11577679, 11578843-11578850
SPROHSA334824	68	GTG	-	11577258-11577317, 11577592-11577679, 11578843-11578904
SPROHSA92300	51	AGG	-	11577258-11577317, 11577592-11577679, 11578479-11578489
SPROHSA155060	52	ATG	-	11577258-11577317, 11577592-11577679, 11578479-11578492
SPROHSA344859	62	GTG	-	11577258-11577317, 11577592-11577679, 11578479-11578522
SPROHSA75566	51	AGG	-	11577258-11577317, 11577592-11577679, 11578584-11578594