SmProt

Specific Information of Small Protein : SPROHSA178840

General Information

Small Protein ID	SPROHSA178840
Organism	Human (Homo sapiens)
Small Protein Sequence	MLVSLLPDGHVDGAAHPASLVATLPG*
RNA Sequence	ATGCTTGTCTCTCTTCTCCCAGATGGACATGTGGACGGCGCTGCTCATCCTGCAAGCCTTGTTGCTACCCTCCCTGGCTGA
Protein Length	26
Start Codon	ATG
Location	chr19:11577258-11577339:-
Blocks	11577258-11577339
Mean PhyloCSF	-7.09625926135
Data Source	Ribosome profiling;
Related Genes	ENSG00000198551; ZNF627; ENSG00000102575; ACP5;
Mass (Da)	mono. 2537.3; avg. 2538.9

Ribosome profiling

Ribo-seq ID	Ensembl Gene ID	Ensembl Transcript ID	Symbol	Gene Type	TIS Type	Ribo P value	TIS P value	Start On Trans	Stop On Trans	In-frame Count	Ribo-seq RPKM
SRR5512738	ENSG00000102575.12	ENST00000590832.1	ACP5	Protein_coding	5'UTR	0.033329	None	188	269	10	15.6504796

Min Ribo P value	0.033329
Min TIS P value	None

Ribo-seq ID	Cell or Tissue	Phenotype	Ribo-seq Source Details	PMID
SRR5512738	GM19147-Lymphoblastoid Cell Line	WT	GSM2601312	29950183;

Database information

No results

Literature information

No results

Mass Spectrometry Information

No results

Function and Disease

Functional domain prediction

Analysis	Signature Accession	Signature Description	Start location	Stop location	Score	Status of the match	InterPro accession	InterPro description	GO	Pathways
No results

Disease	Detected
No results

Related Variants

Variant ID	Consequence to sORF	rsID	Ribo-seq ID
No results

Related Small Proteins with Different TISs

SmProt ID	Small Protein Length	Start Codon	Strand	Blocks
SPROHSA342233	16	GTG	-	11577258-11577309