Specific Information of Small Protein : SPROHSA264935
General Information
| Small Protein ID | SPROHSA264935 |
| Organism | Human (Homo sapiens) |
| Small Protein Sequence | LQQHHQVQSRGPGNKGSGTGSSTLEPTSLSEPPVTGLCLPLDGHVDGAAHPASLVATLPG* |
| RNA Sequence | CTGCAGCAACACCATCAGGTACAGAGCCGAGGCCCAGGGAATAAAGGCTCAGGGACCGGCAGTTCTACTCTAGAGCCCACCAGCCTCTCAGAGCCTCCGGTGACTGGCCTGTGTCTCCCCCTGGATGGACATGTGGACGGCGCTGCTCATCCTGCAAGCCTTGTTGCTACCCTCCCTGGCTGA |
| Protein Length | 60 |
| Start Codon | CTG |
| Location | chr19:11577258-11578112:- |
| Blocks | 11577258-11577317,11577592-11577679,11578075-11578112 |
| Mean PhyloCSF | -7.51084151685 |
| Data Source | Ribosome profiling; |
| Related Genes | ENSG00000198551; ZNF627; ENSG00000102575; ACP5; |
| Mass (Da) | mono. 5960; avg. 5963.5 |
Ribosome profiling
| Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
|---|
| SRR5512738_alt | ENSG00000102575.12 | ENST00000589792.5 | ACP5 | Protein_coding | 5'UTR | 0.007019 | None | 24 | 207 | 16 | 11.0836184 |
| GSE45785_5_alt | ENSG00000102575.12 | ENST00000589792.5 | ACP5 | Protein_coding | 5'UTR | 0.035821 | None | 24 | 207 | 4 | 22.6437757 |
| Min Ribo P value | 0.007019 |
| Min TIS P value | None |
| Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
|---|
| GSE45785_5_alt | BJ cells | Immortalized | GSM1115216 | 23594524; |
| SRR5512738_alt | GM19147-Lymphoblastoid Cell Line | WT | GSM2601312 | 29950183; |
Mass Spectrometry Information
Function and Disease
| Functional domain prediction |  |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|
| MobiDBLite | mobidb-lite | consensus disorder prediction | 1 | 30 | - | T | | | | |
| MobiDBLite | mobidb-lite | consensus disorder prediction | 1 | 35 | - | T | | | | |
| Disease | Detected |
|---|
| No results |
Related Variants
| Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
|---|
| 19-11577645-T-C | Synonymous p.L24L | rs2071484 | SRR5047771; SRR5512738; SRR810104 |
Related Small Proteins with Different TISs
| SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
|---|
| SPROHSA342233 | 16 | GTG | - | 11577258-11577309 |
SmProt