SmProt

Specific Information of Small Protein : SPROHSA75566

General Information

Small Protein ID	SPROHSA75566
Organism	Human (Homo sapiens)
Small Protein Sequence	RQGGNKGSGTGSSTLEPTSLSEPPVTGLCLPLDGHVDGAAHPASLVATLPG*
RNA Sequence	AGGCAGGGAGGGAATAAAGGCTCAGGGACCGGCAGTTCTACTCTAGAGCCCACCAGCCTCTCAGAGCCTCCGGTGACTGGCCTGTGTCTCCCCCTGGATGGACATGTGGACGGCGCTGCTCATCCTGCAAGCCTTGTTGCTACCCTCCCTGGCTGA
Protein Length	51
Start Codon	AGG
Location	chr19:11577258-11578594:-
Blocks	11577258-11577317,11577592-11577679,11578584-11578594
Mean PhyloCSF	-7.29911538118
Data Source	Ribosome profiling;
Related Genes	ENSG00000198551; ZNF627; ENSG00000102575; ACP5;
Mass (Da)	mono. 4905.5; avg. 4908.4

Ribosome profiling

Ribo-seq ID	Ensembl Gene ID	Ensembl Transcript ID	Symbol	Gene Type	TIS Type	Ribo P value	TIS P value	Start On Trans	Stop On Trans	In-frame Count	Ribo-seq RPKM
SRR5512738_alt	ENSG00000102575.12	ENST00000588524.5	ACP5	Protein_coding	Novel	0.006996	None	196	352	16	13.0019369
GSE45785_5_alt	ENSG00000102575.12	ENST00000588524.5	ACP5	Protein_coding	Novel	0.03561	None	196	352	4	26.5628907
SRR5512738_alt	ENSG00000102575.12	ENST00000218758.9	ACP5	Protein_coding	5'UTR	0.006996	None	205	361	16	13.0019369
GSE45785_5_alt	ENSG00000102575.12	ENST00000218758.9	ACP5	Protein_coding	5'UTR	0.03561	None	205	361	4	26.5628907
SRR5512738_alt	ENSG00000102575.12	ENST00000592828.5	ACP5	Protein_coding	5'UTR	0.006996	None	306	462	16	13.0019369
GSE45785_5_alt	ENSG00000102575.12	ENST00000592828.5	ACP5	Protein_coding	5'UTR	0.03561	None	306	462	4	26.5628907

Min Ribo P value	0.006996
Min TIS P value	None

Ribo-seq ID	Cell or Tissue	Phenotype	Ribo-seq Source Details	PMID
GSE45785_5_alt	BJ cells	Immortalized	GSM1115216	23594524;
SRR5512738_alt	GM19147-Lymphoblastoid Cell Line	WT	GSM2601312	29950183;

Database information

No results

Literature information

No results

Mass Spectrometry Information

No results

Function and Disease

Functional domain prediction

Analysis	Signature Accession	Signature Description	Start location	Stop location	Score	Status of the match	InterPro accession	InterPro description	GO	Pathways
MobiDBLite	mobidb-lite	consensus disorder prediction	1	21	-	T
MobiDBLite	mobidb-lite	consensus disorder prediction	1	26	-	T

Disease	Detected
No results

Related Variants

Variant ID	Consequence to sORF	rsID	Ribo-seq ID
19-11577645-T-C	Synonymous p.L15L	rs2071484	SRR5047771; SRR5512738; SRR810104

Related Small Proteins with Different TISs

SmProt ID	Small Protein Length	Start Codon	Strand	Blocks
SPROHSA342233	16	GTG	-	11577258-11577309