Specific Information of Small Protein : SPROHSA170821
General Information
| Small Protein ID | SPROHSA170821 |
| Organism | Human (Homo sapiens) |
| Small Protein Sequence | MPSAPSQDSYKRRNDEHP* |
| RNA Sequence | ATGCCTTCGGCGCCGAGCCAGGACAGCTACAAGAGGAGAAATGATGAACACCCATAG |
| Protein Length | 18 |
| Start Codon | ATG |
| Location | chr6:98926881-98926938:- |
| Blocks | 98926881-98926938 |
| Mean PhyloCSF | -5.54264913107 |
| Data Source | Ribosome profiling; |
| Related Genes | ENSG00000112234; FBXL4; NONHSAG044429; |
| Mass (Da) | mono. 2114; avg. 2115.2 |
Ribosome profiling
| Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
|---|
| GSE45833_5 | ENSG00000112234.9 | ENST00000229971.2 | FBXL4 | Protein_coding | Internal | 0.029709 | None | 441 | 498 | 6 | 40.5717015 |
| GSE45833_5 | ENSG00000112234.9 | ENST00000369244.7 | FBXL4 | Protein_coding | Internal | 0.029709 | None | 499 | 556 | 6 | 40.5717015 |
| Min Ribo P value | 0.029709 |
| Min TIS P value | None |
| Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
|---|
| GSE45833_5 | BJ cells | Senescence | GSM1047590 | 23594524; |
Mass Spectrometry Information
Function and Disease
| Functional domain prediction |  |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|
| No results |
| Disease | Detected |
|---|
| No results |
Related Variants
| Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
|---|
| 6-98926884-A-T | Stop Loss p.*19K | rs34316889 | SRR627627 |
Related Small Proteins with Different TISs
SmProt