Specific Information of Small Protein : SPROHSA10890
General Information
| Small Protein ID | SPROHSA10890 |
| Organism | Human (Homo sapiens) |
| Small Protein Sequence | KRRNDEHP* |
| RNA Sequence | AAGAGGAGAAATGATGAACACCCATAG |
| Protein Length | 8 |
| Start Codon | AAG |
| Location | chr6:98926881-98926908:- |
| Blocks | 98926881-98926908 |
| Mean PhyloCSF | -5.79903699734 |
| Data Source | Ribosome profiling; |
| Related Genes | ENSG00000112234; FBXL4; NONHSAG044429; |
| Mass (Da) | mono. 1050.5; avg. 1051.1 |
Ribosome profiling
| Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
|---|
| GSE58207_alt | ENSG00000112234.9 | ENST00000229971.2 | FBXL4 | Protein_coding | Internal | 0.007179 | 0.040878 | 471 | 498 | 9 | 34.3288387 |
| GSE58207_alt | ENSG00000112234.9 | ENST00000369244.7 | FBXL4 | Protein_coding | Internal | 0.007179 | 0.040878 | 529 | 556 | 9 | 34.3288387 |
| Min Ribo P value | 0.007179 |
| Min TIS P value | 0.040878 |
| Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
|---|
| GSE58207_alt | HCT116 | Colorectal carcinoma | GSM1403307; GSM1403308 | 25510491; |
Mass Spectrometry Information
Function and Disease
| Functional domain prediction |  |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|
| No results |
| Disease | Detected |
|---|
| No results |
Related Variants
| Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
|---|
| 6-98926884-A-T | Stop Loss p.*9K | rs34316889 | SRR627627 |
Related Small Proteins with Different TISs
SmProt