Specific Information of Small Protein : SPROHSA92855
General Information
| Small Protein ID | SPROHSA92855 |
| Organism | Human (Homo sapiens) |
| Small Protein Sequence | RVASSVFITL |
| RNA Sequence | AGGGTGGCATCGTCTGTCTTTATCACCCTG |
| Protein Length | 10 |
| Start Codon | AGG |
| Location | chr1:15765004-15765034:+ |
| Blocks | 15765004-15765034 |
| Mean PhyloCSF | 7.67349991798 |
| Data Source | Ribosome profiling; |
| Related Genes | ENSG00000162458; FBLIM1; |
| Mass (Da) | mono. 1091.6; avg. 1092.3 |
Ribosome profiling
| Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
|---|
| GSE65778 | ENSG00000162458.13 | ENST00000430076.5 | FBLIM1 | Protein_coding | Truncated | 0.007427 | None | 476 | 506 | 6 | 35.0720353 |
| SRR964946_alt | ENSG00000162458.13 | ENST00000430076.5 | FBLIM1 | Protein_coding | Truncated | 0.012202 | 0.024091 | 476 | 506 | NA | NA |
| Min Ribo P value | 0.007427 |
| Min TIS P value | None |
| Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
|---|
| GSE65778 | HEK293T | WT | GSM1606107; GSM1606108 | 25719440; |
| SRR964946_alt | HEK293 | WT | SRR964946 | 22927429; |
Mass Spectrometry Information
Function and Disease
| Functional domain prediction |  |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|
| No results |
| Disease | Detected |
|---|
| No results |
Related Variants
| Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
|---|
| No results |
Related Small Proteins with Different TISs
SmProt