Specific Information of Small Protein : SPROHSA19780
General Information
| Small Protein ID | SPROHSA19780 |
| Organism | Human (Homo sapiens) |
| Small Protein Sequence | KPEKRVASSVFITL |
| RNA Sequence | AAGCCTGAGAAGAGGGTGGCATCGTCTGTCTTTATCACCCTG |
| Protein Length | 14 |
| Start Codon | AAG |
| Location | chr1:15764992-15765034:+ |
| Blocks | 15764992-15765034 |
| Mean PhyloCSF | 7.28928565979 |
| Data Source | Ribosome profiling; |
| Related Genes | ENSG00000162458; FBLIM1; |
| Mass (Da) | mono. 1573.9; avg. 1574.9 |
Ribosome profiling
| Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
|---|
| GSE45833_2_alt | ENSG00000162458.13 | ENST00000430076.5 | FBLIM1 | Protein_coding | Truncated | 0.031707 | None | 464 | 506 | 17 | 55.5821750 |
| GSE103308_alt | ENSG00000162458.13 | ENST00000430076.5 | FBLIM1 | Protein_coding | Truncated | 0.008943 | None | 464 | 506 | 8 | 16.9431072 |
| SRR964946_alt | ENSG00000162458.13 | ENST00000430076.5 | FBLIM1 | Protein_coding | Truncated | 0.00676 | 0.038754 | 464 | 506 | NA | NA |
| Min Ribo P value | 0.00676 |
| Min TIS P value | None |
| Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
|---|
| GSE103308_alt | RD-muscle | WT | GSM2760247 | 29696588; |
| GSE45833_2_alt | BJ cells | Quiescence | GSM1047586; GSM1047587 | 23594524; |
| SRR964946_alt | HEK293 | WT | SRR964946 | 22927429; |
Mass Spectrometry Information
Function and Disease
| Functional domain prediction |  |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|
| No results |
| Disease | Detected |
|---|
| No results |
Related Variants
| Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
|---|
| No results |
Related Small Proteins with Different TISs
SmProt