Specific Information of Small Protein : SPROHSA117830
General Information
| Small Protein ID | SPROHSA117830 |
| Organism | Human (Homo sapiens) |
| Small Protein Sequence | IIATPGAEAMASKPEKRVASSVFITL |
| RNA Sequence | ATCATTGCCACACCAGGAGCTGAAGCCATGGCCTCAAAGCCTGAGAAGAGGGTGGCATCGTCTGTCTTTATCACCCTG |
| Protein Length | 26 |
| Start Codon | ATC |
| Location | chr1:15764678-15765034:+ |
| Blocks | 15764678-15764685,15764963-15765034 |
| Mean PhyloCSF | 3.00393586587 |
| Data Source | Ribosome profiling; |
| Related Genes | ENSG00000162458; FBLIM1; |
| Mass (Da) | mono. 2686.5; avg. 2688.1 |
Ribosome profiling
| Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
|---|
| GSE123564_1_alt | ENSG00000162458.13 | ENST00000430076.5 | FBLIM1 | Protein_coding | Extended | 0.017862 | None | 428 | 506 | 22 | 56.2391431 |
| GSE123564_1 | ENSG00000162458.13 | ENST00000430076.5 | FBLIM1 | Protein_coding | Extended | 0.017862 | None | 428 | 506 | 22 | 56.2391431 |
| Min Ribo P value | 0.017862 |
| Min TIS P value | None |
| Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
|---|
| GSE123564_1 | Skin fibroblasts | WT | GSM3507221; GSM3507222; GSM3507226; GSM3507227 | 30707697; |
| GSE123564_1_alt | Skin fibroblasts | WT | GSM3507221; GSM3507222; GSM3507226; GSM3507227 | 30707697; |
Mass Spectrometry Information
Function and Disease
| Functional domain prediction |  |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|
| No results |
| Disease | Detected |
|---|
| No results |
Related Variants
| Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
|---|
| No results |
Related Small Proteins with Different TISs
SmProt