Specific Information of Small Protein : SPROHSA11265
General Information
| Small Protein ID | SPROHSA11265 |
| Organism | Human (Homo sapiens) |
| Small Protein Sequence | KRVASSVFITL |
| RNA Sequence | AAGAGGGTGGCATCGTCTGTCTTTATCACCCTG |
| Protein Length | 11 |
| Start Codon | AAG |
| Location | chr1:15765001-15765034:+ |
| Blocks | 15765001-15765034 |
| Mean PhyloCSF | 7.45654539628 |
| Data Source | Ribosome profiling; |
| Related Genes | ENSG00000162458; FBLIM1; |
| Mass (Da) | mono. 1219.7; avg. 1220.5 |
Ribosome profiling
| Min Ribo P value | 0.017043 |
| Min TIS P value | 9.691E-06 |
| Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
|---|
| SRR964946_alt | HEK293 | WT | SRR964946 | 22927429; |
Mass Spectrometry Information
Function and Disease
| Functional domain prediction |  |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|
| No results |
| Disease | Detected |
|---|
| No results |
Related Variants
| Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
|---|
| No results |
Related Small Proteins with Different TISs
SmProt