Specific Information of Small Protein : SPROHSA240027
General Information
| Small Protein ID | SPROHSA240027 |
| Organism | Human (Homo sapiens) |
| Small Protein Sequence | IATPGAEAMASKPEKRVASSVFITL |
| RNA Sequence | ATTGCCACACCAGGAGCTGAAGCCATGGCCTCAAAGCCTGAGAAGAGGGTGGCATCGTCTGTCTTTATCACCCTG |
| Protein Length | 25 |
| Start Codon | ATT |
| Location | chr1:15764681-15765034:+ |
| Blocks | 15764681-15764685,15764963-15765034 |
| Mean PhyloCSF | 3.45797330538 |
| Data Source | Ribosome profiling; |
| Related Genes | ENSG00000162458; FBLIM1; |
| Mass (Da) | mono. 2573.4; avg. 2575 |
Ribosome profiling
| Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
|---|
| GSE45833_5_alt | ENSG00000162458.13 | ENST00000430076.5 | FBLIM1 | Protein_coding | Extended | 0.003714 | None | 431 | 506 | 22 | 113.059808 |
| SRR618770,618771,618772,618773_alt | ENSG00000162458.13 | ENST00000430076.5 | FBLIM1 | Protein_coding | Extended | 0.00244 | 0.022811 | 431 | 506 | 45 | 101.290440 |
| Min Ribo P value | 0.00244 |
| Min TIS P value | None |
| Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
|---|
| GSE45833_5_alt | BJ cells | Senescence | GSM1047590 | 23594524; |
| SRR618770,618771,618772,618773_alt | HEK293 | WT | SRR618770; SRR618771; SRR618772; SRR618773 | NA; |
Mass Spectrometry Information
Function and Disease
| Functional domain prediction |  |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|
| No results |
| Disease | Detected |
|---|
| No results |
Related Variants
| Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
|---|
| No results |
Related Small Proteins with Different TISs
SmProt