Specific Information of Small Protein : SPROHSA67336
General Information
Small Protein ID | SPROHSA67336 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | RTSGQNCLSSEFHAGRKVRRNF* |
RNA Sequence | AGGACCTCTGGTCAAAATTGCCTGAGTTCAGAATTTCATGCTGGAAGGAAAGTTAGACGTAACTTCTAA |
Protein Length | 22 |
Start Codon | AGG |
Location | chr3:101782175-101782244:+ |
Blocks | 101782175-101782244 |
Mean PhyloCSF | -8.42278256624 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000144815; NXPE3; |
Mass (Da) | mono. 2549.3; avg. 2550.8 |
Ribosome profiling
Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
---|
SRR3208921_alt | ENSG00000144815.16 | ENST00000273347.10 | NXPE3 | Protein_coding | 5'UTR | 0.028699 | None | 180 | 249 | 12 | 38.6581329 |
SRR3208921_alt | ENSG00000144815.16 | ENST00000474165.5 | NXPE3 | Protein_coding | 5'UTR | 0.028699 | None | 346 | 415 | 12 | 38.6581329 |
SRR3208921_alt | ENSG00000144815.16 | ENST00000495842.5 | NXPE3 | Protein_coding | 5'UTR | 0.028699 | None | 356 | 425 | 12 | 38.6581329 |
SRR3208921_alt | ENSG00000144815.16 | ENST00000477909.5 | NXPE3 | Protein_coding | 5'UTR | 0.028699 | None | 470 | 539 | 12 | 38.6581329 |
SRR3208921_alt | ENSG00000144815.16 | ENST00000487830.1 | NXPE3 | Protein_coding | Novel | 0.028699 | None | 506 | 575 | 12 | 38.6581329 |
SRR3208921_alt | ENSG00000144815.16 | ENST00000491511.6 | NXPE3 | Protein_coding | 5'UTR | 0.028699 | None | 525 | 594 | 12 | 38.6581329 |
Min Ribo P value | 0.028699 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
SRR3208921_alt | ES cell-derived neurons TSC2-/- | Tuberous sclerosis complex | GSM2082573 | 27655340; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |      |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
No results |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
No results |
Related Small Proteins with Different TISs