Specific Information of Small Protein : SPROHSA63197
General Information
| Small Protein ID | SPROHSA63197 |
| Organism | Human (Homo sapiens) |
| Small Protein Sequence | RKVRRNF* |
| RNA Sequence | AGGAAAGTTAGACGTAACTTCTAA |
| Protein Length | 7 |
| Start Codon | AGG |
| Location | chr3:101782220-101782244:+ |
| Blocks | 101782220-101782244 |
| Mean PhyloCSF | -7.8884999752 |
| Data Source | Ribosome profiling; |
| Related Genes | ENSG00000144815; NXPE3; |
| Mass (Da) | mono. 974.6; avg. 975.2 |
Ribosome profiling
| Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
|---|
| SRR964946_alt | ENSG00000144815.16 | ENST00000273347.10 | NXPE3 | Protein_coding | 5'UTR | 0.027668 | 0.007775 | 225 | 249 | NA | NA |
| SRR964946_alt | ENSG00000144815.16 | ENST00000474165.5 | NXPE3 | Protein_coding | 5'UTR | 0.027668 | 0.030913 | 391 | 415 | NA | NA |
| SRR964946_alt | ENSG00000144815.16 | ENST00000495842.5 | NXPE3 | Protein_coding | 5'UTR | 0.027668 | 0.030913 | 401 | 425 | NA | NA |
| SRR964946_alt | ENSG00000144815.16 | ENST00000477909.5 | NXPE3 | Protein_coding | 5'UTR | 0.027668 | 0.007775 | 515 | 539 | NA | NA |
| SRR964946_alt | ENSG00000144815.16 | ENST00000491511.6 | NXPE3 | Protein_coding | 5'UTR | 0.027668 | 0.007775 | 570 | 594 | NA | NA |
| Min Ribo P value | 0.027668 |
| Min TIS P value | 0.007775 |
| Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
|---|
| SRR964946_alt | HEK293 | WT | SRR964946 | 22927429; |
Mass Spectrometry Information
Function and Disease
| Functional domain prediction |  |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|
| No results |
| Disease | Detected |
|---|
| No results |
Related Variants
| Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
|---|
| No results |
Related Small Proteins with Different TISs
SmProt