Specific Information of Small Protein : SPROHSA136196
General Information
Small Protein IDSPROHSA136196
Organismhuman (Homo sapiens)
Small Protein SequenceMKKMRTSGQNCLSSEFHAGRKVRRNF*
RNA SequenceATGAAAAAAATGAGGACCTCTGGTCAAAATTGCCTGAGTTCAGAATTTCATGCTGGAAGGAAAGTTAGACGTAACTTCTAA
Protein Length26
Start CodonATG
Locationchr3:101782163-101782244:+
Blocks101782163-101782244
Mean PhyloCSF-8.34248141889
Data SourceRibosome profiling; Literature;
Related GenesENSG00000144815; NXPE3;
Ribosome profiling
RiboIDGeneIDTransIDSymbolGeneTypeTISTypeRiboPvalueTISPvalueStartOnTransStopOnTrans
GSE45833_4ENSG00000144815.16ENST00000273347.10NXPE3protein_coding5'UTR0.024738None168249
SRR5047770ENSG00000144815.16ENST00000273347.10NXPE3protein_coding5'UTR0.021112None168249
SRR5047770_altENSG00000144815.16ENST00000273347.10NXPE3protein_coding5'UTR0.021112None168249
SRR618770,618771,618772,618773_altENSG00000144815.16ENST00000273347.10NXPE3protein_coding5'UTR0.0454765.355e-08168249
GSE45833_4ENSG00000144815.16ENST00000474165.5NXPE3protein_coding5'UTR0.024738None334415
GSE45833_4_altENSG00000144815.16ENST00000474165.5NXPE3protein_coding5'UTR0.024738None334415
SRR5047770ENSG00000144815.16ENST00000474165.5NXPE3protein_coding5'UTR0.021112None334415
SRR5047770_altENSG00000144815.16ENST00000474165.5NXPE3protein_coding5'UTR0.021112None334415
SRR618770,618771,618772,618773_altENSG00000144815.16ENST00000474165.5NXPE3protein_coding5'UTR0.0454769.214e-05334415
GSE45833_4ENSG00000144815.16ENST00000495842.5NXPE3protein_coding5'UTR0.024738None344425
GSE45833_4_altENSG00000144815.16ENST00000495842.5NXPE3protein_coding5'UTR0.024738None344425
SRR5047770ENSG00000144815.16ENST00000495842.5NXPE3protein_coding5'UTR0.021112None344425
SRR5047770_altENSG00000144815.16ENST00000495842.5NXPE3protein_coding5'UTR0.021112None344425
SRR618770,618771,618772,618773_altENSG00000144815.16ENST00000495842.5NXPE3protein_coding5'UTR0.0454760.000841344425
GSE45833_4ENSG00000144815.16ENST00000477909.5NXPE3protein_coding5'UTR0.024738None458539
GSE45833_4_altENSG00000144815.16ENST00000477909.5NXPE3protein_coding5'UTR0.024738None458539
SRR5047770ENSG00000144815.16ENST00000477909.5NXPE3protein_coding5'UTR0.021112None458539
SRR5047770_altENSG00000144815.16ENST00000477909.5NXPE3protein_coding5'UTR0.021112None458539
SRR618770,618771,618772,618773_altENSG00000144815.16ENST00000477909.5NXPE3protein_coding5'UTR0.0454765.355e-08458539
GSE45833_4ENSG00000144815.16ENST00000487830.1NXPE3protein_codingNovel0.024738None494575
GSE45833_4_altENSG00000144815.16ENST00000487830.1NXPE3protein_codingNovel0.024738None494575
SRR5047770ENSG00000144815.16ENST00000487830.1NXPE3protein_codingNovel0.021112None494575
SRR5047770_altENSG00000144815.16ENST00000487830.1NXPE3protein_codingNovel0.021112None494575
SRR618770,618771,618772,618773_altENSG00000144815.16ENST00000487830.1NXPE3protein_codingNovel0.0454760.000841494575
GSE45833_4ENSG00000144815.16ENST00000491511.6NXPE3protein_coding5'UTR0.024738None513594
GSE45833_4_altENSG00000144815.16ENST00000491511.6NXPE3protein_coding5'UTR0.024738None513594
SRR5047770ENSG00000144815.16ENST00000491511.6NXPE3protein_coding5'UTR0.021112None513594
SRR5047770_altENSG00000144815.16ENST00000491511.6NXPE3protein_coding5'UTR0.021112None513594
SRR618770,618771,618772,618773_altENSG00000144815.16ENST00000491511.6NXPE3protein_coding5'UTR0.0454765.355e-08513594
Min Ribo Pvalue0.021112
Min TIS Pvalue5.355e-08
RiboIDCellORTissuePhenotypeRiboSourcePMID
GSE45833_4BJ cellsProliferationGSM104758923594524;
GSE45833_4_altBJ cellsProliferationGSM104758923594524;
SRR5047770iPSC-differentiated dopamine neuronsParkinson DiseaseGSM2402496;GSM2402497;GSM2402498NA;
SRR5047770_altiPSC-differentiated dopamine neuronsParkinson DiseaseGSM2402496;GSM2402497;GSM2402498NA;
SRR618770,618771,618772,618773_altHEK293WTSRR618770;SRR618771;SRR618772;SRR618773NA;

Database information
No results
Literature information
PMID26687005;
Cell lines Or TissuesBJ
PhenotypeNULL
Gene IDENSG00000144815
Transcript IDENST00000495842
SymbolNA
ORF TypesORF
Gene Typeprotein_coding
ThroughputHigh-throughput Literature Mining
InteractionNA
Function DescriptionNA
Mass Spectrometry Information
No results
Function and Disease
Functional domain prediction Funtion   
AnalysisSignature AccessionSignature DescriptionStart locationStop locationScoreStatus of the matchInterPro accessionInterPro descriptionGOPathways
No results
DiseaseDetected
No results
Related Variants
VarIDConsequence To sORFrsIDRiboID
No results
Related Small Proteins with Different TISs
IDSmall Protein LengthStart CodonStrandBlocks
SPROHSA631977AGG+101782220-101782244
SPROHSA6733622AGG+101782175-101782244
SPROHSA15385723ATG+101782172-101782244
SPROHSA36376632GTG+101782145-101782244
SPROHSA38937141TTG+101782118-101782244
SPROHSA1444545AAG+101779931-101779934,101782109-101782244
SPROHSA12210458ATC+101779282-101779324,101782109-101782244
References
PMID23594524
Titlep53 induces transcriptional and translational programs to suppress cell proliferation and growth.
JournalGenome Biol. 2013 Apr 17;14(4):R32. doi: 10.1186/gb-2013-14-4-r32.
Authors"Loayza-Puch F, Drost J, Rooijers K, Lopes R, Elkon R, Agami R."
PMID23594524
Titlep53 induces transcriptional and translational programs to suppress cell proliferation and growth
JournalGenome Biol.2013 Apr 17;14(4):R32.doi: 10.1186/gb-2013-14-4-r32.
AuthorsFabricio Loayza-Puch,Jarno Drost,Koos Rooijers,Rui Lopes,Ran Elkon,Reuven Agam
PMID26687005
Title"Many lncRNAs, 5'UTRs, and pseudogenes are translated and some are likely to express functional proteins."
JournalElife. 2015 Dec 19;4:e08890. doi: 10.7554/eLife.08890.
Authors"Ji Z, Song R, Regev A, Struhl K."