SmProt

Specific Information of Small Protein : SPROHSA136196

General Information

Small Protein ID	SPROHSA136196
Organism	Human (Homo sapiens)
Small Protein Sequence	MKKMRTSGQNCLSSEFHAGRKVRRNF*
RNA Sequence	ATGAAAAAAATGAGGACCTCTGGTCAAAATTGCCTGAGTTCAGAATTTCATGCTGGAAGGAAAGTTAGACGTAACTTCTAA
Protein Length	26
Start Codon	ATG
Location	chr3:101782163-101782244:+
Blocks	101782163-101782244
Mean PhyloCSF	-8.34248141889
Data Source	Ribosome profiling; Literature;
Related Genes	ENSG00000144815; NXPE3;
Mass (Da)	mono. 3067.5; avg. 3069.6

Ribosome profiling

Ribo-seq ID	Ensembl Gene ID	Ensembl Transcript ID	Symbol	Gene Type	TIS Type	Ribo P value	TIS P value	Start On Trans	Stop On Trans	In-frame Count	Ribo-seq RPKM
GSE45833_4	ENSG00000144815.16	ENST00000273347.10	NXPE3	Protein_coding	5'UTR	0.024738	None	168	249	13	34.6762586
SRR5047770	ENSG00000144815.16	ENST00000273347.10	NXPE3	Protein_coding	5'UTR	0.021112	None	168	249	36	35.2623085
SRR5047770_alt	ENSG00000144815.16	ENST00000273347.10	NXPE3	Protein_coding	5'UTR	0.021112	None	168	249	36	35.2623085
SRR618770,618771,618772,618773_alt	ENSG00000144815.16	ENST00000273347.10	NXPE3	Protein_coding	5'UTR	0.045476	5.355E-08	168	249	12	25.0099852
GSE45833_4	ENSG00000144815.16	ENST00000474165.5	NXPE3	Protein_coding	5'UTR	0.024738	None	334	415	13	34.6762586
GSE45833_4_alt	ENSG00000144815.16	ENST00000474165.5	NXPE3	Protein_coding	5'UTR	0.024738	None	334	415	13	34.6762586
SRR5047770	ENSG00000144815.16	ENST00000474165.5	NXPE3	Protein_coding	5'UTR	0.021112	None	334	415	36	35.2623085
SRR5047770_alt	ENSG00000144815.16	ENST00000474165.5	NXPE3	Protein_coding	5'UTR	0.021112	None	334	415	36	35.2623085
SRR618770,618771,618772,618773_alt	ENSG00000144815.16	ENST00000474165.5	NXPE3	Protein_coding	5'UTR	0.045476	9.214E-05	334	415	12	25.0099852
GSE45833_4	ENSG00000144815.16	ENST00000495842.5	NXPE3	Protein_coding	5'UTR	0.024738	None	344	425	13	34.6762586
GSE45833_4_alt	ENSG00000144815.16	ENST00000495842.5	NXPE3	Protein_coding	5'UTR	0.024738	None	344	425	13	34.6762586
SRR5047770	ENSG00000144815.16	ENST00000495842.5	NXPE3	Protein_coding	5'UTR	0.021112	None	344	425	36	35.2623085
SRR5047770_alt	ENSG00000144815.16	ENST00000495842.5	NXPE3	Protein_coding	5'UTR	0.021112	None	344	425	36	35.2623085
SRR618770,618771,618772,618773_alt	ENSG00000144815.16	ENST00000495842.5	NXPE3	Protein_coding	5'UTR	0.045476	0.000841	344	425	12	25.0099852
GSE45833_4	ENSG00000144815.16	ENST00000477909.5	NXPE3	Protein_coding	5'UTR	0.024738	None	458	539	13	34.6762586
GSE45833_4_alt	ENSG00000144815.16	ENST00000477909.5	NXPE3	Protein_coding	5'UTR	0.024738	None	458	539	13	34.6762586
SRR5047770	ENSG00000144815.16	ENST00000477909.5	NXPE3	Protein_coding	5'UTR	0.021112	None	458	539	36	35.2623085
SRR5047770_alt	ENSG00000144815.16	ENST00000477909.5	NXPE3	Protein_coding	5'UTR	0.021112	None	458	539	36	35.2623085
SRR618770,618771,618772,618773_alt	ENSG00000144815.16	ENST00000477909.5	NXPE3	Protein_coding	5'UTR	0.045476	5.355E-08	458	539	12	25.0099852
GSE45833_4	ENSG00000144815.16	ENST00000487830.1	NXPE3	Protein_coding	Novel	0.024738	None	494	575	13	34.6762586
GSE45833_4_alt	ENSG00000144815.16	ENST00000487830.1	NXPE3	Protein_coding	Novel	0.024738	None	494	575	13	34.6762586
SRR5047770	ENSG00000144815.16	ENST00000487830.1	NXPE3	Protein_coding	Novel	0.021112	None	494	575	36	35.2623085
SRR5047770_alt	ENSG00000144815.16	ENST00000487830.1	NXPE3	Protein_coding	Novel	0.021112	None	494	575	36	35.2623085
SRR618770,618771,618772,618773_alt	ENSG00000144815.16	ENST00000487830.1	NXPE3	Protein_coding	Novel	0.045476	0.000841	494	575	12	25.0099852
GSE45833_4	ENSG00000144815.16	ENST00000491511.6	NXPE3	Protein_coding	5'UTR	0.024738	None	513	594	13	34.6762586
GSE45833_4_alt	ENSG00000144815.16	ENST00000491511.6	NXPE3	Protein_coding	5'UTR	0.024738	None	513	594	13	34.6762586
SRR5047770	ENSG00000144815.16	ENST00000491511.6	NXPE3	Protein_coding	5'UTR	0.021112	None	513	594	36	35.2623085
SRR5047770_alt	ENSG00000144815.16	ENST00000491511.6	NXPE3	Protein_coding	5'UTR	0.021112	None	513	594	36	35.2623085
SRR618770,618771,618772,618773_alt	ENSG00000144815.16	ENST00000491511.6	NXPE3	Protein_coding	5'UTR	0.045476	5.355E-08	513	594	12	25.0099852

Min Ribo P value	0.021112
Min TIS P value	5.355E-08

Ribo-seq ID	Cell or Tissue	Phenotype	Ribo-seq Source Details	PMID
GSE45833_4	BJ cells	Proliferation	GSM1047589	23594524;
GSE45833_4_alt	BJ cells	Proliferation	GSM1047589	23594524;
SRR5047770	iPSC-differentiated dopamine neurons	Parkinson Disease	GSM2402496; GSM2402497; GSM2402498	NA;
SRR5047770_alt	iPSC-differentiated dopamine neurons	Parkinson Disease	GSM2402496; GSM2402497; GSM2402498	NA;
SRR618770,618771,618772,618773_alt	HEK293	WT	SRR618770; SRR618771; SRR618772; SRR618773	NA;

Database information

No results

Literature information

PMID	26687005;
Cell lines Or Tissues	BJ
Phenotype	NULL
Gene ID	ENSG00000144815
Transcript ID	ENST00000495842
Symbol	NA
ORF Type	sORF
Gene Type	protein_coding
Throughput	High-throughput Literature Mining
Interaction	NA
Function Description	NA

Mass Spectrometry Information

No results

Function and Disease

Functional domain prediction

Analysis	Signature Accession	Signature Description	Start location	Stop location	Score	Status of the match	InterPro accession	InterPro description	GO	Pathways
No results

Disease	Detected
No results

Related Variants

Variant ID	Consequence to sORF	rsID	Ribo-seq ID
No results

Related Small Proteins with Different TISs

SmProt ID	Small Protein Length	Start Codon	Strand	Blocks
SPROHSA63197	7	AGG	+	101782220-101782244
SPROHSA67336	22	AGG	+	101782175-101782244
SPROHSA153857	23	ATG	+	101782172-101782244
SPROHSA363766	32	GTG	+	101782145-101782244
SPROHSA389371	41	TTG	+	101782118-101782244
SPROHSA14445	45	AAG	+	101779931-101779934, 101782109-101782244
SPROHSA122104	58	ATC	+	101779282-101779324, 101782109-101782244

a reliable repository with comprehensive annotation of small proteins derived from ribosome profiling