Specific Information of Small Protein : SPROHSA370315
General Information
| Small Protein ID | SPROHSA370315 |
| Organism | Human (Homo sapiens) |
| Small Protein Sequence | LTERNPLKTSA* |
| RNA Sequence | TTGACTGAGAGAAACCCACTGAAGACGTCTGCGTGA |
| Protein Length | 11 |
| Start Codon | TTG |
| Location | chr12:46372525-46372561:- |
| Blocks | 46372525-46372561 |
| Mean PhyloCSF | -6.64105561044 |
| Data Source | Ribosome profiling; Literature; |
| Related Genes | ENSG00000134294; SLC38A2; ENSG00000258096; AC025031.2; NONHSAG010985;NONHSAG010986; |
| Mass (Da) | mono. 1228.7; avg. 1229.4 |
Ribosome profiling
| Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
|---|
| GSE45785_2_alt | ENSG00000134294.14 | ENST00000549258.5 | SLC38A2 | Protein_coding | 5'UTR | 0.000393 | None | 210 | 246 | 49 | 805.742093 |
| GSE105082_alt | ENSG00000134294.14 | ENST00000549258.5 | SLC38A2 | Protein_coding | 5'UTR | 0.000988 | None | 210 | 246 | 1045 | 1972.57762 |
| GSE45785_2_alt | ENSG00000134294.14 | ENST00000256689.10 | SLC38A2 | Protein_coding | 5'UTR | 0.000393 | None | 212 | 248 | 49 | 805.742093 |
| GSE45785_2_alt | ENSG00000134294.14 | ENST00000553252.1 | SLC38A2 | Protein_coding | Novel | 0.000393 | None | 212 | 248 | 49 | 805.742093 |
| GSE105082_alt | ENSG00000134294.14 | ENST00000256689.10 | SLC38A2 | Protein_coding | 5'UTR | 0.000988 | None | 212 | 248 | 1045 | 1972.57762 |
| GSE105082_alt | ENSG00000134294.14 | ENST00000553252.1 | SLC38A2 | Protein_coding | Novel | 0.000988 | None | 212 | 248 | 1045 | 1972.57762 |
| Min Ribo P value | 0.000393 |
| Min TIS P value | None |
| Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
|---|
| GSE105082_alt | HELA | Cervical cancer | GSM2817679; GSM2817680 | 30591072; |
| GSE45785_2_alt | BJ cells | Immortalized | GSM1115207 | 23594524; |
Literature information
| PMID | 26687005; |
| Cell lines Or Tissues | BJ |
| Phenotype | NULL |
| Gene ID | ENSG00000134294 |
| Transcript ID | ENST00000553252 |
| Symbol | NA |
| ORF Type | sORF |
| Gene Type | protein_coding |
| Throughput | High-throughput Literature Mining |
| Interaction | NA |
| Function Description | NA |
Mass Spectrometry Information
Function and Disease
| Functional domain prediction |  |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|
| No results |
| Disease | Detected |
|---|
| No results |
Related Variants
| Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
|---|
| No results |
Related Small Proteins with Different TISs
SmProt