SmProt

Specific Information of Small Protein : SPROHSA80490

General Information

Small Protein ID	SPROHSA80490
Organism	Human (Homo sapiens)
Small Protein Sequence	RRSVMPLEDWMNILQEPDEGGHAG*
RNA Sequence	AGGCGGAGCGTCATGCCTCTGGAAGACTGGATGAATATTCTCCAGGAGCCTGACGAAGGCGGCCATGCTGGATAA
Protein Length	24
Start Codon	AGG
Location	chr9:120843379-120847308:+
Blocks	120843379-120843439,120847293-120847308
Mean PhyloCSF	-7.30752002716
Data Source	Ribosome profiling;
Related Genes	ENSG00000226752; CUTALP; NONHSAG053338;
Mass (Da)	mono. 2736.3; avg. 2738

Ribosome profiling

Ribo-seq ID	Ensembl Gene ID	Ensembl Transcript ID	Symbol	Gene Type	TIS Type	Ribo P value	TIS P value	Start On Trans	Stop On Trans	In-frame Count	Ribo-seq RPKM
GSE105082_alt	ENSG00000226752.9	ENST00000640391.1	CUTALP	Transcribed_unitary_pseudogene	Novel	0.003078	None	384	459	10	9.06064365

Min Ribo P value	0.003078
Min TIS P value	None

Ribo-seq ID	Cell or Tissue	Phenotype	Ribo-seq Source Details	PMID
GSE105082_alt	HELA	Cervical cancer	GSM2817679; GSM2817680	30591072;

Database information

No results

Literature information

No results

Mass Spectrometry Information

No results

Function and Disease

Functional domain prediction

Analysis	Signature Accession	Signature Description	Start location	Stop location	Score	Status of the match	InterPro accession	InterPro description	GO	Pathways
MobiDBLite	mobidb-lite	consensus disorder prediction	1	24	-	T

Disease	Detected
No results

Related Variants

Variant ID	Consequence to sORF	rsID	Ribo-seq ID
No results

Related Small Proteins with Different TISs

SmProt ID	Small Protein Length	Start Codon	Strand	Blocks
SPROHSA170051	20	ATG	+	120843391-120843439, 120847293-120847308
SPROHSA301125	32	CTG	+	120843355-120843439, 120847293-120847308
SPROHSA372006	34	TTG	+	120843349-120843439, 120847293-120847308
SPROHSA55337	51	ACG	+	120843298-120843439, 120847293-120847308
SPROHSA187238	57	ATG	+	120843280-120843439, 120847293-120847308