Specific Information of Small Protein : SPROHSA170051
General Information
| Small Protein ID | SPROHSA170051 |
| Organism | Human (Homo sapiens) |
| Small Protein Sequence | MPLEDWMNILQEPDEGGHAG* |
| RNA Sequence | ATGCCTCTGGAAGACTGGATGAATATTCTCCAGGAGCCTGACGAAGGCGGCCATGCTGGATAA |
| Protein Length | 20 |
| Start Codon | ATG |
| Location | chr9:120843391-120847308:+ |
| Blocks | 120843391-120843439,120847293-120847308 |
| Mean PhyloCSF | -7.82095239276 |
| Data Source | Ribosome profiling; |
| Related Genes | ENSG00000226752; CUTALP; NONHSAG053338; |
| Mass (Da) | mono. 2238; avg. 2239.4 |
Ribosome profiling
| Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
|---|
| GSE103308 | ENSG00000226752.9 | ENST00000640391.1 | CUTALP | Transcribed_unitary_pseudogene | Novel | 0.031505 | None | 396 | 459 | 5 | 7.05962801 |
| GSE105082 | ENSG00000226752.9 | ENST00000640391.1 | CUTALP | Transcribed_unitary_pseudogene | Novel | 0.010048 | None | 396 | 459 | 9 | 9.70783249 |
| Min Ribo P value | 0.010048 |
| Min TIS P value | None |
| Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
|---|
| GSE103308 | RD-muscle | WT | GSM2760247 | 29696588; |
| GSE105082 | HELA | Cervical cancer | GSM2817679; GSM2817680 | 30591072; |
Mass Spectrometry Information
Function and Disease
| Functional domain prediction |  |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|
| No results |
| Disease | Detected |
|---|
| No results |
Related Variants
| Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
|---|
| No results |
Related Small Proteins with Different TISs
| SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
|---|
| SPROHSA80490 | 24 | AGG | + | 120843379-120843439, 120847293-120847308 |
| SPROHSA301125 | 32 | CTG | + | 120843355-120843439, 120847293-120847308 |
| SPROHSA372006 | 34 | TTG | + | 120843349-120843439, 120847293-120847308 |
| SPROHSA55337 | 51 | ACG | + | 120843298-120843439, 120847293-120847308 |
| SPROHSA187238 | 57 | ATG | + | 120843280-120843439, 120847293-120847308 |
SmProt