Specific Information of Small Protein : SPROHSA136204
General Information
Small Protein IDSPROHSA136204
Organismhuman (Homo sapiens)
Small Protein SequenceMKKLPSPYITNLCCAPTRTCFKFPWQFTTPILYQARL
RNA SequenceATGAAAAAACTACCATCCCCGTATATAACTAATTTGTGCTGTGCACCAACAAGAACCTGCTTTAAATTTCCATGGCAATTTACAACCCCCATACTGTACCAGGCAAGGTTA
Protein Length37
Start CodonATG
Locationchr14:58285586-58285697:-
Blocks58285586-58285697
Mean PhyloCSF0
Data SourceRibosome profiling;
Related GenesENSG00000139971; ARMH4; ENSG00000257621; PSMA3-AS1; NONHSAG015097;NONHSAG015108;
Ribosome profiling
RiboIDGeneIDTransIDSymbolGeneTypeTISTypeRiboPvalueTISPvalueStartOnTransStopOnTrans
SRR4045276ENSG00000257621.8ENST00000557412.1PSMA3-AS1lncRNANovel0.011028None443554
GSE105082ENSG00000257621.8ENST00000557412.1PSMA3-AS1lncRNANovel0.001027None443554
GSE83493ENSG00000257621.8ENST00000557412.1PSMA3-AS1lncRNANovel0.011028None443554
GSE83493_altENSG00000257621.8ENST00000557412.1PSMA3-AS1lncRNANovel0.011028None443554
SRR618770,618771,618772,618773_altENSG00000257621.8ENST00000557412.1PSMA3-AS1lncRNANovel0.0301290.002859443554
Min Ribo Pvalue0.001027
Min TIS PvalueNone
RiboIDCellORTissuePhenotypeRiboSourcePMID
GSE105082HELAcervical cancerGSM2817679;GSM281768030591072;
GSE83493HeLa S3cervical cancerGSM2204389;GSM2204390;GSM2204391;GSM220439228460002;
GSE83493_altHeLa S3cervical cancerGSM2204389;GSM2204390;GSM2204391;GSM220439228460002;
SRR4045276Meg01 cellsWTGSM228590927681415;
SRR618770,618771,618772,618773_altHEK293WTSRR618770;SRR618771;SRR618772;SRR618773NA;

Database information
No results
Literature information
No results
Mass Spectrometry Information
No results
Function and Disease
Functional domain prediction Funtion   
AnalysisSignature AccessionSignature DescriptionStart locationStop locationScoreStatus of the matchInterPro accessionInterPro descriptionGOPathways
No results
DiseaseDetected
No results
Related Variants
VarIDConsequence To sORFrsIDRiboID
No results
Related Small Proteins with Different TISs
IDSmall Protein LengthStart CodonStrandBlocks
SPROHSA25226239CTG-58285586-58285703
SPROHSA1751445AAG-58285586-58285721
SPROHSA24648448ATT-58285586-58285730
SPROHSA23000949ATT-58285586-58285733
References
PMID27681415
TitleDynamic Regulation of a Ribosome Rescue Pathway in Erythroid Cells and Platelets
JournalCell Rep.2016 Sep 27;17(1):1-10.doi: 10.1016/j.celrep.2016.08.088.
AuthorsEric W Mills,Jamie Wangen,Rachel Green,Nicholas T Ingolia
PMID28460002
TitleProteomic analysis of polyribosomes identifies splicing factors as potential regulators of translation during mitosis
JournalNucleic Acids Res.2017 Jun 2;45(10):5945-5957.doi: 10.1093/nar/gkx326.
AuthorsRanen Aviner,Sarah Hofmann,Tamar Elman,Anjana Shenoy,Tamar Geiger,Ran Elkon,Marcelo Ehrlich,Orna Elroy-Stein
PMID30591072
TitleRNA G-quadruplexes at upstream open reading frames cause DHX36- and DHX9-dependent translation of human mRNAs
JournalGenome Biol.2018 Dec 27;19(1):229.doi: 10.1186/s13059-018-1602-2.
AuthorsPierre Murat,Giovanni Marsico,Barbara Herdy,Avazeh T Ghanbarian,Guillem Portella,Shankar Balasubramanian