Specific Information of Small Protein : SPROHSA56693
General Information
Small Protein ID | SPROHSA56693 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | TASSSHLGPDREVSSGRSPISAAITTEPGPPTQVQGQPP* |
RNA Sequence | ACGGCTTCTTCCAGTCACCTCGGCCCGGATCGGGAAGTGTCAAGCGGGCGCTCCCCCATCTCCGCCGCTATTACCACTGAACCCGGACCCCCTACCCAGGTCCAGGGCCAGCCGCCATGA |
Protein Length | 39 |
Start Codon | ACG |
Location | chr1:109090756-109090876:+ |
Blocks | 109090756-109090876 |
Mean PhyloCSF | -3.10724999961 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000273382; AL356488.3; ENSG00000215717; TMEM167B; NONHSAG002324; |
Mass (Da) | mono. 3895.9; avg. 3898.2 |
Ribosome profiling
Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
---|
GSE45785_3_alt | ENSG00000215717.6 | ENST00000338272.8 | TMEM167B | Protein_coding | 5'UTR | 0.002401 | None | 954 | 1074 | 49 | 172.212470 |
GSE58207_alt | ENSG00000215717.6 | ENST00000338272.8 | TMEM167B | Protein_coding | 5'UTR | 0.046624 | 0.040878 | 954 | 1074 | 33 | 28.3212919 |
GSE94613_2_alt | ENSG00000215717.6 | ENST00000338272.8 | TMEM167B | Protein_coding | 5'UTR | 0.006634 | None | 954 | 1074 | 45 | 78.0314922 |
GSE83493_alt | ENSG00000215717.6 | ENST00000338272.8 | TMEM167B | Protein_coding | 5'UTR | 0.028811 | None | 954 | 1074 | 28 | 27.9628452 |
Min Ribo P value | 0.002401 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE45785_3_alt | BJ cells | Immortalized | GSM1115210 | 23594524; |
GSE58207_alt | HCT116 | Colorectal carcinoma | GSM1403307; GSM1403308 | 25510491; |
GSE83493_alt | HeLa S3 | Cervical cancer | GSM2204389; GSM2204390; GSM2204391; GSM2204392 | 28460002; |
GSE94613_2_alt | MOLM13 | Acute myeloid leukemia | GSM2481053 | 29186125; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |      |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
MobiDBLite | mobidb-lite | consensus disorder prediction | 1 | 39 | - | T | | | | |
Disease | Detected |
---|
No results |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
1-109090871-C-T | Non-Synonymous p.P39S | . | SRR5239058 |
Related Small Proteins with Different TISs