Specific Information of Small Protein : SPROHSA25947
General Information
Small Protein ID | SPROHSA25947 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | KDKRSPALLAAPDSSQCLA* |
RNA Sequence | AAGGACAAAAGGAGCCCAGCGCTACTAGCTGCACCCGATTCCTCCCAGTGCTTAGCATGA |
Protein Length | 19 |
Start Codon | AAG |
Location | chr12:46371289-46371349:- |
Blocks | 46371289-46371349 |
Mean PhyloCSF | -4.47081663013 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000134294; SLC38A2; NONHSAG010985;NONHSAG010986; |
Mass (Da) | mono. 1970; avg. 1971.2 |
Ribosome profiling
Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
---|
GSE45833_4_alt | ENSG00000134294.14 | ENST00000551405.1 | SLC38A2 | Protein_coding | Novel | 0.020836 | None | 156 | 216 | 31 | 111.630878 |
GSE45833_4_alt | ENSG00000134294.14 | ENST00000549258.5 | SLC38A2 | Protein_coding | 5'UTR | 0.020836 | None | 293 | 353 | 31 | 111.630878 |
GSE45833_4_alt | ENSG00000134294.14 | ENST00000256689.10 | SLC38A2 | Protein_coding | 5'UTR | 0.020836 | None | 295 | 355 | 31 | 111.630878 |
GSE45833_4_alt | ENSG00000134294.14 | ENST00000553252.1 | SLC38A2 | Protein_coding | Novel | 0.020836 | None | 295 | 355 | 31 | 111.630878 |
GSE45833_4_alt | ENSG00000134294.14 | ENST00000547252.5 | SLC38A2 | Protein_coding | Novel | 0.020836 | None | 84 | 144 | 31 | 111.630878 |
Min Ribo P value | 0.020836 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE45833_4_alt | BJ cells | Proliferation | GSM1047589 | 23594524; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |      |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
No results |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
No results |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
SPROHSA104715 | 34 | ATA | - | 46371289-46371379, 46372508-46372523 |
SPROHSA324731 | 36 | GTG | - | 46371289-46371379, 46372508-46372529 |
SPROHSA61077 | 31 | ACG | - | 46371289-46371379, 46372320-46372326 |