Specific Information of Small Protein : SPROHSA61077
General Information
Small Protein ID | SPROHSA61077 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | TWADSRAAAPTAKDKRSPALLAAPDSSQCLA* |
RNA Sequence | ACGTGGGCCGACTCGCGGGCCGCTGCACCCACCGCCAAGGACAAAAGGAGCCCAGCGCTACTAGCTGCACCCGATTCCTCCCAGTGCTTAGCATGA |
Protein Length | 31 |
Start Codon | ACG |
Location | chr12:46371289-46372326:- |
Blocks | 46371289-46371379,46372320-46372326 |
Mean PhyloCSF | -5.28599998976 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000134294; SLC38A2; ENSG00000258096; AC025031.2; NONHSAG010985;NONHSAG010986; |
Mass (Da) | mono. 3168.6; avg. 3170.5 |
Ribosome profiling
Min Ribo P value | 0.049722 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE89183_alt | CD34+ hematopoietic cells-Erythroid | WT | GSM2360179; GSM2360180 | 29551269; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |       |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
No results |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
No results |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
SPROHSA25947 | 19 | AAG | - | 46371289-46371349 |