Specific Information of Small Protein : SPROHSA104715
General Information
Small Protein ID | SPROHSA104715 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | IETTEADSRAAAPTAKDKRSPALLAAPDSSQCLA* |
RNA Sequence | ATAGAGACCACCGAGGCCGACTCGCGGGCCGCTGCACCCACCGCCAAGGACAAAAGGAGCCCAGCGCTACTAGCTGCACCCGATTCCTCCCAGTGCTTAGCATGA |
Protein Length | 34 |
Start Codon | ATA |
Location | chr12:46371289-46372523:- |
Blocks | 46371289-46371379,46372508-46372523 |
Mean PhyloCSF | -5.17644758111 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000134294; SLC38A2; ENSG00000258096; AC025031.2; NONHSAG010985;NONHSAG010986; |
Mass (Da) | mono. 3454.7; avg. 3456.8 |
Ribosome profiling
Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
---|
GSE103308_alt | ENSG00000134294.14 | ENST00000549258.5 | SLC38A2 | Protein_coding | 5'UTR | 0.020196 | None | 248 | 353 | 71 | 60.1480306 |
GSE83493_alt | ENSG00000134294.14 | ENST00000549258.5 | SLC38A2 | Protein_coding | 5'UTR | 0.047004 | None | 248 | 353 | 118 | 134.678193 |
SRR964946_alt | ENSG00000134294.14 | ENST00000549258.5 | SLC38A2 | Protein_coding | 5'UTR | 0.027393 | 0.015915 | 248 | 353 | NA | NA |
GSE103308_alt | ENSG00000134294.14 | ENST00000256689.10 | SLC38A2 | Protein_coding | 5'UTR | 0.020196 | None | 250 | 355 | 71 | 60.1480306 |
GSE103308_alt | ENSG00000134294.14 | ENST00000553252.1 | SLC38A2 | Protein_coding | Novel | 0.020196 | None | 250 | 355 | 71 | 60.1480306 |
GSE83493_alt | ENSG00000134294.14 | ENST00000256689.10 | SLC38A2 | Protein_coding | 5'UTR | 0.047004 | None | 250 | 355 | 118 | 134.678193 |
GSE83493_alt | ENSG00000134294.14 | ENST00000553252.1 | SLC38A2 | Protein_coding | Novel | 0.047004 | None | 250 | 355 | 118 | 134.678193 |
SRR964946_alt | ENSG00000134294.14 | ENST00000256689.10 | SLC38A2 | Protein_coding | 5'UTR | 0.027393 | 0.015915 | 250 | 355 | NA | NA |
Min Ribo P value | 0.020196 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE103308_alt | RD-muscle | WT | GSM2760247 | 29696588; |
GSE83493_alt | HeLa S3 | Cervical cancer | GSM2204389; GSM2204390; GSM2204391; GSM2204392 | 28460002; |
SRR964946_alt | HEK293 | WT | SRR964946 | 22927429; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |       |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
No results |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
12-46372512-G-C | Synonymous p.T4T | . | SRR5239050; SRR5239051; SRR5239052 |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
SPROHSA25947 | 19 | AAG | - | 46371289-46371349 |
SPROHSA324731 | 36 | GTG | - | 46371289-46371379, 46372508-46372529 |