Specific Information of Small Protein : SPROHSA136191
General Information
Small Protein IDSPROHSA136191
Organismhuman (Homo sapiens)
Small Protein SequenceMKKRRNNGRTKKGRGHVQPICDTNCAQCVPKDKAINKFIIGNTVEAAAVRDISEASVFDAYVLPKLYLKLHYCLSCAIHSKVVRNRSCEAHKD*
RNA SequenceATGAAAAAAAGAAGGAACAACGGTCGTACCAAAAAGGGCCGCGGCCACGTGCAGCCTATTTGCGACACGAACTGTGCCCAATGTGTGCCCAAGGACAAGGCTATTAACAAATTCATCATTGGAAACACAGTGGAGGCTGCAGCAGTCAGGGACATTTCTGAAGCGAGCGTCTTTGATGCCTATGTGCTTCCCAAGCTGTATTTGAAGCTACATTACTGTCTGAGTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTTGTGAAGCCCACAAGGACTGA
Protein Length93
Start CodonATG
Locationchr9:95123523-95123805:+
Blocks95123523-95123805
Mean PhyloCSF0
Data SourceRibosome profiling;
Related GenesENSG00000158169; FANCC; ENSG00000223849; AL354893.1; NONHSAG052920;NONHSAG101513;
Ribosome profiling
RiboIDGeneIDTransIDSymbolGeneTypeTISTypeRiboPvalueTISPvalueStartOnTransStopOnTrans
GSE94454ENSG00000223849.1ENST00000433735.1AL354893.1processed_pseudogeneNovel0.016816None3285
SRR5350740ENSG00000223849.1ENST00000433735.1AL354893.1processed_pseudogeneNovel0.036248None3285
GSE83493ENSG00000223849.1ENST00000433735.1AL354893.1processed_pseudogeneNovel0.046958None3285
Min Ribo Pvalue0.016816
Min TIS PvalueNone
RiboIDCellORTissuePhenotypeRiboSourcePMID
GSE83493HeLa S3cervical cancerGSM2204389;GSM2204390;GSM2204391;GSM220439228460002;
GSE94454Huh7hepatomaGSM2476003;GSM2476004;GSM247600528323820;
SRR5350740MCF7breast adenocarcinomaGSM253888428388414;

Database information
No results
Literature information
No results
Mass Spectrometry Information
No results
Function and Disease
Functional domain prediction Funtion   
AnalysisSignature AccessionSignature DescriptionStart locationStop locationScoreStatus of the matchInterPro accessionInterPro descriptionGOPathways
No results
DiseaseDetected
No results
Related Variants
VarIDConsequence To sORFrsIDRiboID
No results
Related Small Proteins with Different TISs
IDSmall Protein LengthStart CodonStrandBlocks
SPROHSA31008928CTG+95123718-95123805
SPROHSA33882332GTG+95123706-95123805
SPROHSA24676242ATT+95123676-95123805
References
PMID28323820
TitleSelective stalling of human translation through small-molecule engagement of the ribosome nascent chain
JournalPLoS Biol.2017 Mar 21;15(3):e2001882.doi: 10.1371/journal.pbio.2001882.eCollection 2017 Mar.
AuthorsNathanael G Lintner,Kim F McClure,Donna Petersen,Allyn T Londregan,David W Piotrowski,Liuqing Wei,Jun Xiao,Michael Bolt,Paula M Loria,Bruce Maguire,Kieran F Geoghegan,Austin Huang,Tim Rolph,Spiros Liras,Jennifer A Doudna,Robert G Dullea,Jamie H D Cate
PMID28388414
TitleTranscription Impacts the Efficiency of mRNA Translation via Co-transcriptional N6-adenosine Methylation
JournalCell.2017 Apr 6;169(2):326-337.e12.doi: 10.1016/j.cell.2017.03.031.
AuthorsBoris Slobodin,Ruiqi Han,Vittorio Calderone,Joachim A F Oude Vrielink,Fabricio Loayza-Puch,Ran Elkon,Reuven Agami
PMID28460002
TitleProteomic analysis of polyribosomes identifies splicing factors as potential regulators of translation during mitosis
JournalNucleic Acids Res.2017 Jun 2;45(10):5945-5957.doi: 10.1093/nar/gkx326.
AuthorsRanen Aviner,Sarah Hofmann,Tamar Elman,Anjana Shenoy,Tamar Geiger,Ran Elkon,Marcelo Ehrlich,Orna Elroy-Stein