Specific Information of Small Protein : SPROHSA65165
General Information
Small Protein ID | SPROHSA65165 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | RNTNKLFSRIRLILWEN* |
RNA Sequence | AGGAATACTAACAAATTATTTTCAAGAATAAGACTGATTTTATGGGAAAATTAA |
Protein Length | 17 |
Start Codon | AGG |
Location | chr14:58291679-58293091:- |
Blocks | 58291679-58291707,58293065-58293091 |
Mean PhyloCSF | -8.75549994575 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000139971; ARMH4; ENSG00000257621; PSMA3-AS1; ENSG00000252782; RNU6-341P; NONHSAG015097;NONHSAG015108; |
Mass (Da) | mono. 2172.2; avg. 2173.5 |
Ribosome profiling
Min Ribo P value | 0.024252 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
SRR4045276_alt | Meg01 cells | WT | GSM2285909 | 27681415; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |      |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
No results |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
No results |
Related Small Proteins with Different TISs