Specific Information of Small Protein : SPROHSA4970
General Information
Small Protein ID | SPROHSA4970 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | KNKTDFMGKLSRCSSLRNLDLRSVCGLYE* |
RNA Sequence | AAGAATAAGACTGATTTTATGGGAAAATTAAGCAGATGCTCCAGTTTGAGAAACCTGGATCTGCGATCTGTTTGTGGTCTCTATGAATAA |
Protein Length | 29 |
Start Codon | AAG |
Location | chr14:58274121-58297957:- |
Blocks | 58274121-58274135,58291634-58291707,58297954-58297957 |
Mean PhyloCSF | -8.54905557103 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000139971; ARMH4; ENSG00000257621; PSMA3-AS1; ENSG00000180189; HMGB1P14; ENSG00000279636; AL132989.2; ENSG00000252782; RNU6-341P; NONHSAG015097;NONHSAG015108;NONHSAG068810; |
Mass (Da) | mono. 3332.7; avg. 3334.8 |
Ribosome profiling
Min Ribo P value | 0.04585 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
SRR5350740_alt | MCF7 | Breast adenocarcinoma | GSM2538884 | 28388414; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |      |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
No results |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
No results |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
SPROHSA370549 | 14 | TTG | - | 58274121-58274135, 58291634-58291665 |
SPROHSA200504 | 23 | ATG | - | 58274121-58274135, 58291634-58291692 |