Specific Information of Small Protein : SPROHSA389792
General Information
| Small Protein ID | SPROHSA389792 |
| Organism | Human (Homo sapiens) |
| Small Protein Sequence | LSARESPWSLFKFWRLSLWVGLITCY* |
| RNA Sequence | TTGTCAGCGAGGGAGTCCCCATGGTCTCTGTTCAAGTTCTGGAGACTTTCTCTTTGGGTGGGCTTAATCACCTGCTACTAA |
| Protein Length | 26 |
| Start Codon | TTG |
| Location | chr1:117121253-117121334:- |
| Blocks | 117121253-117121334 |
| Mean PhyloCSF | -6.19892586896 |
| Data Source | Ribosome profiling; |
| Related Genes | ENSG00000134253; TRIM45; NONHSAG056777; |
| Mass (Da) | mono. 3157.7; avg. 3159.7 |
Ribosome profiling
| Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
|---|
| SRR5047770_alt | ENSG00000134253.10 | ENST00000256649.9 | TRIM45 | Protein_coding | 5'UTR | 0.034283 | None | 415 | 496 | 3 | 2.93852571 |
| SRR5047770_alt | ENSG00000134253.10 | ENST00000369464.7 | TRIM45 | Protein_coding | 5'UTR | 0.034283 | None | 428 | 509 | 3 | 2.93852571 |
| Min Ribo P value | 0.034283 |
| Min TIS P value | None |
| Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
|---|
| SRR5047770_alt | iPSC-differentiated dopamine neurons | Parkinson Disease | GSM2402496; GSM2402497; GSM2402498 | NA; |
Mass Spectrometry Information
Function and Disease
| Functional domain prediction |       |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|
| No results |
| Disease | Detected |
|---|
| No results |
Related Variants
| Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
|---|
| No results |
Related Small Proteins with Different TISs