Specific Information of Small Protein : SPROHSA388937
General Information
Small Protein ID | SPROHSA388937 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | LVATLGRLVGGHPTLPSSMETRRESPA* |
RNA Sequence | TTGGTTGCCACACTGGGGAGACTGGTGGGTGGTCACCCCACCCTACCCTCATCCATGGAAACCCGGAGGGAGAGTCCCGCCTGA |
Protein Length | 27 |
Start Codon | TTG |
Location | chr1:203627106-203627190:+ |
Blocks | 203627106-203627190 |
Mean PhyloCSF | -4.39378574916 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000058668; ATP2B4; NONHSAG105657; |
Mass (Da) | mono. 2831.5; avg. 2833.2 |
Ribosome profiling
Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
---|
SRR3208885_alt | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.001435 | None | 320 | 404 | 66 | 141.162322 |
GSE45785_1_alt | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.001443 | None | 320 | 404 | 22 | 171.704797 |
GSE45833_2_alt | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.003826 | None | 320 | 404 | 24 | 39.2344765 |
GSE45833_6_alt | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.00707 | None | 320 | 404 | 77 | 156.633493 |
SRR3208921_alt | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.030472 | None | 320 | 404 | 87 | 230.222987 |
GSE129869_alt | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.001486 | None | 320 | 404 | 17 | 367.362892 |
GSE103308_alt | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.000459 | None | 320 | 404 | 23 | 24.3557166 |
GSE105082_alt | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.000927 | None | 320 | 404 | 14 | 11.3258045 |
GSE94613_2_alt | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.000429 | None | 320 | 404 | 54 | 133.768272 |
GSE94613_1_alt | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.008445 | None | 320 | 404 | 22 | 151.287807 |
SRR7207252_alt | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.01221 | None | 320 | 404 | 11 | 34.6308348 |
SRR2991181_alt | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.025468 | None | 320 | 404 | 14 | 27.2412967 |
SRR964946_alt | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.000261 | 0.007775 | 320 | 404 | NA | NA |
SRR3208885_alt | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.001435 | None | 546 | 630 | 66 | 141.162322 |
GSE45785_1_alt | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.001443 | None | 546 | 630 | 22 | 171.704797 |
GSE45833_2_alt | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.003826 | None | 546 | 630 | 24 | 39.2344765 |
GSE45833_6_alt | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.00707 | None | 546 | 630 | 77 | 156.633493 |
SRR3208921_alt | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.030472 | None | 546 | 630 | 87 | 230.222987 |
GSE129869_alt | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.001486 | None | 546 | 630 | 17 | 367.362892 |
GSE103308_alt | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.000459 | None | 546 | 630 | 23 | 24.3557166 |
GSE105082_alt | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.000927 | None | 546 | 630 | 14 | 11.3258045 |
GSE94613_2_alt | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.000429 | None | 546 | 630 | 54 | 133.768272 |
GSE94613_1_alt | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.008445 | None | 546 | 630 | 22 | 151.287807 |
SRR7207252_alt | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.01221 | None | 546 | 630 | 11 | 34.6308348 |
SRR2991181_alt | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.025468 | None | 546 | 630 | 14 | 27.2412967 |
SRR964946_alt | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.000261 | 0.007775 | 546 | 630 | NA | NA |
Min Ribo P value | 0.000261 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE103308_alt | RD-muscle | WT | GSM2760247 | 29696588; |
GSE105082_alt | HELA | Cervical cancer | GSM2817679; GSM2817680 | 30591072; |
GSE129869_alt | Foreskin Fibroblasts | WT | GSM3723750; GSM3723751; GSM3723752 | 31167946; |
GSE45785_1_alt | BJ cells | WT | GSM1115204 | 23594524; |
GSE45833_2_alt | BJ cells | Quiescence | GSM1047586; GSM1047587 | 23594524; |
GSE45833_6_alt | BJ cells | Transformed | GSM1047591 | 23594524; |
GSE94613_1_alt | MOLM13 | Acute myeloid leukemia | GSM2481052 | 29186125; |
GSE94613_2_alt | MOLM13 | Acute myeloid leukemia | GSM2481053 | 29186125; |
SRR2991181_alt | SH-SY5Y | Neuroblastoma | GSM1970518 | 31109297; |
SRR3208885_alt | ES cell-derived neurons TSC2+/+ | WT | GSM2082537 | 27655340; |
SRR3208921_alt | ES cell-derived neurons TSC2-/- | Tuberous sclerosis complex | GSM2082573 | 27655340; |
SRR7207252_alt | MCF10A-ER-Src | Breast adenocarcinoma | GSM3150265 | 30089253; |
SRR964946_alt | HEK293 | WT | SRR964946 | 22927429; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |      |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
MobiDBLite | mobidb-lite | consensus disorder prediction | 1 | 27 | - | T | | | | |
Disease | Detected |
---|
No results |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
1-203627152-C-T | Non-Synonymous p.P16S | rs76857273 | SRR5047771 |
1-203627190-A-G | Stop Loss p.*28W | rs4600103 | SRR3208885; SRR3208921; SRR4045276; SRR5047770; SRR5047771; SRR5047772; SRR5239056; SRR5239058; SRR5350745; SRR5382423; SRR6053333; SRR7207252; SRR8907185; SRR8907187; SRR8310196; SRR8310197; SRR8310201; SRR8310198; SRR8310199; SRR8310200; SRR8310205; SRR627622; SRR627623; SRR627625; SRR627626; SRR627627; SRR810100; SRR810101; SRR810102; SRR810103; SRR810104; SRR1795425; SRR964946 |
Related Small Proteins with Different TISs