Specific Information of Small Protein : SPROHSA303150
General Information
Small Protein ID | SPROHSA303150 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | LGRLVGGHPTLPSSMETRRESPA* |
RNA Sequence | CTGGGGAGACTGGTGGGTGGTCACCCCACCCTACCCTCATCCATGGAAACCCGGAGGGAGAGTCCCGCCTGA |
Protein Length | 23 |
Start Codon | CTG |
Location | chr1:203627118-203627190:+ |
Blocks | 203627118-203627190 |
Mean PhyloCSF | -4.83762503664 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000058668; ATP2B4; NONHSAG105657; |
Mass (Da) | mono. 2447.3; avg. 2448.8 |
Ribosome profiling
Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
---|
GSE45785_5_alt | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.000185 | None | 332 | 404 | 30 | 431.646974 |
GSE45833_5_alt | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.004238 | None | 332 | 404 | 60 | 321.192637 |
GSE45833_4_alt | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.01511 | None | 332 | 404 | 37 | 111.030712 |
GSE45785_2_alt | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.0229 | None | 332 | 404 | 29 | 238.433884 |
SRR964946_alt | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.003038 | 0.000232 | 332 | 404 | NA | NA |
GSE45785_5_alt | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.000185 | None | 558 | 630 | 30 | 431.646974 |
GSE45833_5_alt | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.004238 | None | 558 | 630 | 60 | 321.192637 |
GSE45833_4_alt | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.01511 | None | 558 | 630 | 37 | 111.030712 |
GSE45785_2_alt | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.0229 | None | 558 | 630 | 29 | 238.433884 |
SRR964946_alt | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.003038 | 0.000232 | 558 | 630 | NA | NA |
Min Ribo P value | 0.000185 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE45785_2_alt | BJ cells | Immortalized | GSM1115207 | 23594524; |
GSE45785_5_alt | BJ cells | Immortalized | GSM1115216 | 23594524; |
GSE45833_4_alt | BJ cells | Proliferation | GSM1047589 | 23594524; |
GSE45833_5_alt | BJ cells | Senescence | GSM1047590 | 23594524; |
SRR964946_alt | HEK293 | WT | SRR964946 | 22927429; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |      |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
MobiDBLite | mobidb-lite | consensus disorder prediction | 1 | 23 | - | T | | | | |
Disease | Detected |
---|
No results |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
1-203627152-C-T | Non-Synonymous p.P12S | rs76857273 | SRR5047771 |
1-203627190-A-G | Stop Loss p.*24W | rs4600103 | SRR3208885; SRR3208921; SRR4045276; SRR5047770; SRR5047771; SRR5047772; SRR5239056; SRR5239058; SRR5350745; SRR5382423; SRR6053333; SRR7207252; SRR8907185; SRR8907187; SRR8310196; SRR8310197; SRR8310201; SRR8310198; SRR8310199; SRR8310200; SRR8310205; SRR627622; SRR627623; SRR627625; SRR627626; SRR627627; SRR810100; SRR810101; SRR810102; SRR810103; SRR810104; SRR1795425; SRR964946 |
Related Small Proteins with Different TISs