Specific Information of Small Protein : SPROHSA303150
General Information
| Small Protein ID | SPROHSA303150 |
| Organism | Human (Homo sapiens) |
| Small Protein Sequence | LGRLVGGHPTLPSSMETRRESPA* |
| RNA Sequence | CTGGGGAGACTGGTGGGTGGTCACCCCACCCTACCCTCATCCATGGAAACCCGGAGGGAGAGTCCCGCCTGA |
| Protein Length | 23 |
| Start Codon | CTG |
| Location | chr1:203627118-203627190:+ |
| Blocks | 203627118-203627190 |
| Mean PhyloCSF | -4.83762503664 |
| Data Source | Ribosome profiling; |
| Related Genes | ENSG00000058668; ATP2B4; NONHSAG105657; |
| Mass (Da) | mono. 2447.3; avg. 2448.8 |
Ribosome profiling
| Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
|---|
| GSE45785_5_alt | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.000185 | None | 332 | 404 | 30 | 431.646974 |
| GSE45833_5_alt | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.004238 | None | 332 | 404 | 60 | 321.192637 |
| GSE45833_4_alt | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.01511 | None | 332 | 404 | 37 | 111.030712 |
| GSE45785_2_alt | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.0229 | None | 332 | 404 | 29 | 238.433884 |
| SRR964946_alt | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.003038 | 0.000232 | 332 | 404 | NA | NA |
| GSE45785_5_alt | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.000185 | None | 558 | 630 | 30 | 431.646974 |
| GSE45833_5_alt | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.004238 | None | 558 | 630 | 60 | 321.192637 |
| GSE45833_4_alt | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.01511 | None | 558 | 630 | 37 | 111.030712 |
| GSE45785_2_alt | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.0229 | None | 558 | 630 | 29 | 238.433884 |
| SRR964946_alt | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.003038 | 0.000232 | 558 | 630 | NA | NA |
| Min Ribo P value | 0.000185 |
| Min TIS P value | None |
| Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
|---|
| GSE45785_2_alt | BJ cells | Immortalized | GSM1115207 | 23594524; |
| GSE45785_5_alt | BJ cells | Immortalized | GSM1115216 | 23594524; |
| GSE45833_4_alt | BJ cells | Proliferation | GSM1047589 | 23594524; |
| GSE45833_5_alt | BJ cells | Senescence | GSM1047590 | 23594524; |
| SRR964946_alt | HEK293 | WT | SRR964946 | 22927429; |
Mass Spectrometry Information
Function and Disease
| Functional domain prediction |  |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|
| MobiDBLite | mobidb-lite | consensus disorder prediction | 1 | 23 | - | T | | | | |
| Disease | Detected |
|---|
| No results |
Related Variants
| Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
|---|
| 1-203627152-C-T | Non-Synonymous p.P12S | rs76857273 | SRR5047771 |
| 1-203627190-A-G | Stop Loss p.*24W | rs4600103 | SRR3208885; SRR3208921; SRR4045276; SRR5047770; SRR5047771; SRR5047772; SRR5239056; SRR5239058; SRR5350745; SRR5382423; SRR6053333; SRR7207252; SRR8907185; SRR8907187; SRR8310196; SRR8310197; SRR8310201; SRR8310198; SRR8310199; SRR8310200; SRR8310205; SRR627622; SRR627623; SRR627625; SRR627626; SRR627627; SRR810100; SRR810101; SRR810102; SRR810103; SRR810104; SRR1795425; SRR964946 |
Related Small Proteins with Different TISs
SmProt