Specific Information of Small Protein : SPROHSA179558
General Information
Small Protein ID | SPROHSA179558 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | METRRESPA* |
RNA Sequence | ATGGAAACCCGGAGGGAGAGTCCCGCCTGA |
Protein Length | 9 |
Start Codon | ATG |
Location | chr1:203627160-203627190:+ |
Blocks | 203627160-203627190 |
Mean PhyloCSF | -5.19070005417 |
Data Source | Ribosome profiling; Literature; |
Related Genes | ENSG00000058668; ATP2B4; NONHSAG105657; |
Mass (Da) | mono. 1075.5; avg. 1076.2 |
Ribosome profiling
Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
---|
SRR3208885 | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.008639 | None | 374 | 404 | 49 | 293.446524 |
GSE45833_5 | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.02022 | None | 374 | 404 | 32 | 411.126575 |
GSE45785_2 | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.029557 | None | 374 | 404 | 16 | 315.719350 |
GSE45785_5 | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.042294 | None | 374 | 404 | 11 | 379.849337 |
GSE103308 | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.007663 | None | 374 | 404 | 5 | 14.8252188 |
GSE105082 | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.029557 | None | 374 | 404 | 4 | 9.06064365 |
SRR5047771 | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.005744 | None | 374 | 404 | 171 | 260.673564 |
SRR5047770 | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.016 | None | 374 | 404 | 36 | 95.2082331 |
SRR5047770_alt | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.016 | None | 374 | 404 | 36 | 95.2082331 |
GSE94613_2 | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.003242 | None | 374 | 404 | 22 | 152.594918 |
GSE83493 | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.019027 | None | 374 | 404 | 27 | 107.856688 |
GSE83493_alt | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.019027 | None | 374 | 404 | 27 | 107.856688 |
SRR2991181 | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.029557 | None | 374 | 404 | 13 | 70.8273715 |
SRR5350745 | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.007663 | None | 374 | 404 | 4 | 78.3940201 |
SRR5350745_alt | ENSG00000058668.14 | ENST00000367218.7 | ATP2B4 | Protein_coding | 5'UTR | 0.007663 | None | 374 | 404 | 4 | 78.3940201 |
SRR3208885 | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.008639 | None | 600 | 630 | 49 | 293.446524 |
GSE45833_5 | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.02022 | None | 600 | 630 | 32 | 411.126575 |
GSE45785_2 | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.029557 | None | 600 | 630 | 16 | 315.719350 |
GSE45785_5 | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.042294 | None | 600 | 630 | 11 | 379.849337 |
GSE103308 | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.007663 | None | 600 | 630 | 5 | 14.8252188 |
GSE105082 | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.029557 | None | 600 | 630 | 4 | 9.06064365 |
SRR5047771 | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.005744 | None | 600 | 630 | 171 | 260.673564 |
SRR5047770 | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.016 | None | 600 | 630 | 36 | 95.2082331 |
SRR5047770_alt | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.016 | None | 600 | 630 | 36 | 95.2082331 |
GSE94613_2 | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.003242 | None | 600 | 630 | 22 | 152.594918 |
GSE83493 | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.019027 | None | 600 | 630 | 27 | 107.856688 |
GSE83493_alt | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.019027 | None | 600 | 630 | 27 | 107.856688 |
SRR2991181 | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.029557 | None | 600 | 630 | 13 | 70.8273715 |
SRR5350745 | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.007663 | None | 600 | 630 | 4 | 78.3940201 |
SRR5350745_alt | ENSG00000058668.14 | ENST00000357681.9 | ATP2B4 | Protein_coding | 5'UTR | 0.007663 | None | 600 | 630 | 4 | 78.3940201 |
Min Ribo P value | 0.003242 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE103308 | RD-muscle | WT | GSM2760247 | 29696588; |
GSE105082 | HELA | Cervical cancer | GSM2817679; GSM2817680 | 30591072; |
GSE45785_2 | BJ cells | Immortalized | GSM1115207 | 23594524; |
GSE45785_5 | BJ cells | Immortalized | GSM1115216 | 23594524; |
GSE45833_5 | BJ cells | Senescence | GSM1047590 | 23594524; |
GSE83493 | HeLa S3 | Cervical cancer | GSM2204389; GSM2204390; GSM2204391; GSM2204392 | 28460002; |
GSE83493_alt | HeLa S3 | Cervical cancer | GSM2204389; GSM2204390; GSM2204391; GSM2204392 | 28460002; |
GSE94613_2 | MOLM13 | Acute myeloid leukemia | GSM2481053 | 29186125; |
SRR2991181 | SH-SY5Y | Neuroblastoma | GSM1970518 | 31109297; |
SRR3208885 | ES cell-derived neurons TSC2+/+ | WT | GSM2082537 | 27655340; |
SRR5047770 | iPSC-differentiated dopamine neurons | Parkinson Disease | GSM2402496; GSM2402497; GSM2402498 | NA; |
SRR5047770_alt | iPSC-differentiated dopamine neurons | Parkinson Disease | GSM2402496; GSM2402497; GSM2402498 | NA; |
SRR5047771 | iPSC-differentiated dopamine neurons | Parkinson Disease | NA | NA; |
SRR5350745 | H1933 | NSCLC | GSM2538904 | 28388414; |
SRR5350745_alt | H1933 | NSCLC | GSM2538904 | 28388414; |
Literature information
PMID | 26687005; |
Cell lines Or Tissues | BJ |
Phenotype | NULL |
Gene ID | ENSG00000058668 |
Transcript ID | ENST00000391954 |
Symbol | ATP2B4 |
ORF Type | sORF |
Gene Type | protein_coding |
Throughput | High-throughput Literature Mining |
Interaction | NA |
Function Description | NA |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |      |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
No results |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
1-203627190-A-G | Stop Loss p.*10W | rs4600103 | SRR3208885; SRR3208921; SRR4045276; SRR5047770; SRR5047771; SRR5047772; SRR5239056; SRR5239058; SRR5350745; SRR5382423; SRR6053333; SRR7207252; SRR8907185; SRR8907187; SRR8310196; SRR8310197; SRR8310201; SRR8310198; SRR8310199; SRR8310200; SRR8310205; SRR627622; SRR627623; SRR627625; SRR627626; SRR627627; SRR810100; SRR810101; SRR810102; SRR810103; SRR810104; SRR1795425; SRR964946 |
Related Small Proteins with Different TISs