Specific Information of Small Protein : SPROHSA383348
General Information
| Small Protein ID | SPROHSA383348 |
| Organism | Human (Homo sapiens) |
| Small Protein Sequence | LAFLGCISEGKSS* |
| RNA Sequence | ttggcatttcttggctgtatctctgaaggaaagtcatcttaa |
| Protein Length | 13 |
| Start Codon | ttg |
| Location | chr15:40045967-40046009:+ |
| Blocks | 40045967-40046009 |
| Mean PhyloCSF | -8.40292862483 |
| Data Source | Ribosome profiling; |
| Related Genes | ENSG00000248508; SRP14-AS1; NONHSAG070257; |
| Mass (Da) | mono. 1310.7; avg. 1311.5 |
Ribosome profiling
| Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
|---|
| GSE103308_alt | ENSG00000248508.8 | ENST00000560341.2 | SRP14-AS1 | LncRNA | Novel | 0.031707 | None | 107 | 149 | 3 | 6.35366521 |
| GSE103308_alt | ENSG00000248508.8 | ENST00000660446.1 | SRP14-AS1 | LncRNA | Novel | 0.031707 | None | 151 | 193 | 3 | 6.35366521 |
| GSE103308_alt | ENSG00000248508.8 | ENST00000661955.1 | SRP14-AS1 | LncRNA | Novel | 0.031707 | None | 151 | 193 | 3 | 6.35366521 |
| GSE103308_alt | ENSG00000248508.8 | ENST00000668306.1 | SRP14-AS1 | LncRNA | Novel | 0.031707 | None | 151 | 193 | 3 | 6.35366521 |
| GSE103308_alt | ENSG00000248508.8 | ENST00000504245.6 | SRP14-AS1 | LncRNA | Novel | 0.031707 | None | 160 | 202 | 3 | 6.35366521 |
| GSE103308_alt | ENSG00000248508.8 | ENST00000667323.1 | SRP14-AS1 | LncRNA | Novel | 0.031707 | None | 165 | 207 | 3 | 6.35366521 |
| GSE103308_alt | ENSG00000248508.8 | ENST00000655221.1 | SRP14-AS1 | LncRNA | Novel | 0.031707 | None | 192 | 234 | 3 | 6.35366521 |
| GSE103308_alt | ENSG00000248508.8 | ENST00000559012.2 | SRP14-AS1 | LncRNA | Novel | 0.031707 | None | 214 | 256 | 3 | 6.35366521 |
| Min Ribo P value | 0.031707 |
| Min TIS P value | None |
| Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
|---|
| GSE103308_alt | RD-muscle | WT | GSM2760247 | 29696588; |
Mass Spectrometry Information
Function and Disease
| Functional domain prediction |  |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|
| No results |
| Disease | Detected |
|---|
| No results |
Related Variants
| Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
|---|
| No results |
Related Small Proteins with Different TISs
| SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
|---|
| SPROHSA300893 | 18 | ctg | + | 40039440-40039448, 40045960-40046009 |
| SPROHSA177329 | 19 | atg | + | 40039437-40039448, 40045960-40046009 |
| SPROHSA109571 | 23 | ata | + | 40039425-40039448, 40045960-40046009 |
SmProt