Specific Information of Small Protein : SPROHSA109571
General Information
| Small Protein ID | SPROHSA109571 |
| Organism | Human (Homo sapiens) |
| Small Protein Sequence | IFSCMLGRSNLAFLGCISEGKSS* |
| RNA Sequence | atattcagctgtatgctgggcaggtccaacttggcatttcttggctgtatctctgaaggaaagtcatcttaa |
| Protein Length | 23 |
| Start Codon | ata |
| Location | chr15:40039425-40046009:+ |
| Blocks | 40039425-40039448,40045960-40046009 |
| Mean PhyloCSF | -8.1312222547 |
| Data Source | Ribosome profiling; |
| Related Genes | ENSG00000248508; SRP14-AS1; NONHSAG070257; |
| Mass (Da) | mono. 2419.2; avg. 2420.8 |
Ribosome profiling
| Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
|---|
| GSE83493_alt | ENSG00000248508.8 | ENST00000660446.1 | SRP14-AS1 | LncRNA | Novel | 0.003994 | None | 121 | 193 | 9 | 14.9800956 |
| GSE83493_alt | ENSG00000248508.8 | ENST00000661955.1 | SRP14-AS1 | LncRNA | Novel | 0.003994 | None | 121 | 193 | 9 | 14.9800956 |
| GSE83493_alt | ENSG00000248508.8 | ENST00000668306.1 | SRP14-AS1 | LncRNA | Novel | 0.003994 | None | 121 | 193 | 9 | 14.9800956 |
| GSE83493_alt | ENSG00000248508.8 | ENST00000504245.6 | SRP14-AS1 | LncRNA | Novel | 0.003994 | None | 130 | 202 | 9 | 14.9800956 |
| GSE83493_alt | ENSG00000248508.8 | ENST00000667323.1 | SRP14-AS1 | LncRNA | Novel | 0.003994 | None | 135 | 207 | 9 | 14.9800956 |
| GSE83493_alt | ENSG00000248508.8 | ENST00000655221.1 | SRP14-AS1 | LncRNA | Novel | 0.003994 | None | 162 | 234 | 9 | 14.9800956 |
| GSE83493_alt | ENSG00000248508.8 | ENST00000559012.2 | SRP14-AS1 | LncRNA | Novel | 0.003994 | None | 184 | 256 | 9 | 14.9800956 |
| GSE83493_alt | ENSG00000248508.8 | ENST00000560341.2 | SRP14-AS1 | LncRNA | Novel | 0.003994 | None | 77 | 149 | 9 | 14.9800956 |
| Min Ribo P value | 0.003994 |
| Min TIS P value | None |
| Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
|---|
| GSE83493_alt | HeLa S3 | Cervical cancer | GSM2204389; GSM2204390; GSM2204391; GSM2204392 | 28460002; |
Mass Spectrometry Information
Function and Disease
| Functional domain prediction |  |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|
| No results |
| Disease | Detected |
|---|
| No results |
Related Variants
| Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
|---|
| No results |
Related Small Proteins with Different TISs
| SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
|---|
| SPROHSA383348 | 13 | ttg | + | 40045967-40046009 |
| SPROHSA300893 | 18 | ctg | + | 40039440-40039448, 40045960-40046009 |
| SPROHSA177329 | 19 | atg | + | 40039437-40039448, 40045960-40046009 |
SmProt