Specific Information of Small Protein : SPROHSA370547
General Information
Small Protein ID | SPROHSA370547 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | LRNLDLRSVCGTSIKMIYGNKI* |
RNA Sequence | TTGAGAAACCTGGATCTGCGATCTGTTTGTGGTACCAGCATCAAGATGATTTATGGTAATAAGATATAA |
Protein Length | 22 |
Start Codon | TTG |
Location | chr14:58267387-58291665:- |
Blocks | 58267387-58267393,58273978-58274010,58291634-58291665 |
Mean PhyloCSF | -8.16852176708 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000139971; ARMH4; ENSG00000100567; PSMA3; ENSG00000258682; AL132989.1; ENSG00000257621; PSMA3-AS1; ENSG00000180189; HMGB1P14; ENSG00000279636; AL132989.2; NONHSAG015097;NONHSAG015106;NONHSAG015108;NONHSAG068810; |
Mass (Da) | mono. 2493.4; avg. 2495 |
Ribosome profiling
Min Ribo P value | 0.005233 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE105082_alt | HELA | Cervical cancer | GSM2817679; GSM2817680 | 30591072; |
SRR5047770_alt | iPSC-differentiated dopamine neurons | Parkinson Disease | GSM2402496; GSM2402497; GSM2402498 | NA; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |      |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
No results |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
No results |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
SPROHSA160278 | 7 | ATG | - | 58267387-58267393, 58273978-58273996 |
SPROHSA200502 | 31 | ATG | - | 58267387-58267393, 58273978-58274010, 58291634-58291692 |
SPROHSA4968 | 37 | AAG | - | 58267387-58267393, 58273978-58274010, 58291634-58291707, 58297954-58297957 |