Specific Information of Small Protein : SPROHSA369346
General Information
Small Protein ID | SPROHSA369346 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | LTMRLWHVLTLNAKWNLCKKRLPF* |
RNA Sequence | TTGACAATGCGTCTCTGGCACGTCTTGACCTTGAACGCAAAGTGGAATCTTTGCAAGAAGAGATTGCCTTTTTGA |
Protein Length | 24 |
Start Codon | TTG |
Location | chr10:17233590-17233665:+ |
Blocks | 17233590-17233665 |
Mean PhyloCSF | -7.89559997559 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000026025; VIM; ENSG00000234961; AL133415.1; NONHSAG005322;NONHSAG005323; |
Mass (Da) | mono. 2980.7; avg. 2982.7 |
Ribosome profiling
Min Ribo P value | 0.039886 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
SRR5350744_alt | PC9 | NSCLC | GSM2538903 | 28388414; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |      |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
No results |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
10-17233617-G-A | Synonymous p.L9L | . | SRR5239051 |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
SPROHSA223967 | 25 | ATG | + | 17233587-17233665 |
SPROHSA45320 | 68 | ACG | + | 17229918-17229985, 17230649-17230710, 17233586-17233665 |