SmProt

Specific Information of Small Protein : SPROHSA223967

General Information

Small Protein ID	SPROHSA223967
Organism	Human (Homo sapiens)
Small Protein Sequence	MLTMRLWHVLTLNAKWNLCKKRLPF*
RNA Sequence	ATGTTGACAATGCGTCTCTGGCACGTCTTGACCTTGAACGCAAAGTGGAATCTTTGCAAGAAGAGATTGCCTTTTTGA
Protein Length	25
Start Codon	ATG
Location	chr10:17233587-17233665:+
Blocks	17233587-17233665
Mean PhyloCSF	-7.82473074473
Data Source	Ribosome profiling;
Related Genes	ENSG00000026025; VIM; ENSG00000234961; AL133415.1; NONHSAG005322;NONHSAG005323;
Mass (Da)	mono. 3111.7; avg. 3113.9

Ribosome profiling

Ribo-seq ID	Ensembl Gene ID	Ensembl Transcript ID	Symbol	Gene Type	TIS Type	Ribo P value	TIS P value	Start On Trans	Stop On Trans	In-frame Count	Ribo-seq RPKM
SRR5350744	ENSG00000026025.16	ENST00000495528.1	VIM	Protein_coding	Novel	0.040585	None	363	441	8	39.9120004

Min Ribo P value	0.040585
Min TIS P value	None

Ribo-seq ID	Cell or Tissue	Phenotype	Ribo-seq Source Details	PMID
SRR5350744	PC9	NSCLC	GSM2538903	28388414;

Database information

No results

Literature information

No results

Mass Spectrometry Information

No results

Function and Disease

Functional domain prediction

Analysis	Signature Accession	Signature Description	Start location	Stop location	Score	Status of the match	InterPro accession	InterPro description	GO	Pathways
No results

Disease	Detected
No results

Related Variants

Variant ID	Consequence to sORF	rsID	Ribo-seq ID
10-17233617-G-A	Synonymous p.L10L	.	SRR5239051

Related Small Proteins with Different TISs

SmProt ID	Small Protein Length	Start Codon	Strand	Blocks
SPROHSA369346	24	TTG	+	17233590-17233665
SPROHSA45320	68	ACG	+	17229918-17229985, 17230649-17230710, 17233586-17233665