Specific Information of Small Protein : SPROHSA311389
General Information
Small Protein IDSPROHSA311389
Organismhuman (Homo sapiens)
Small Protein SequenceLSGDRCTLSSLGKTQRRLGIFLGGRGPAPRRHHVPGDPVLR
RNA SequenceCTGTCCGGGGATCGCTGCACGCTGAGCTCCCTCGGCAAGACCCAGCGGCGGCTCGGGATTTTTTTGGGGGGGCGGGGACCAGCCCCGCGCCGGCACCATGTTCCTGGCGACCCTGTACTTCGC
Protein Length41
Start CodonCTG
Locationchr10:116272003-116272126:-
Blocks116272003-116272126
Mean PhyloCSF-5.02729269063
Data SourceRibosome profiling;
Related GenesENSG00000151892; GFRA1;
Mass (Da)mono. 4432.4; avg. 4435.1
Ribosome profiling
RiboIDGeneIDTransIDSymbolGeneTypeTISTypeRiboPvalueTISPvalueStartOnTransStopOnTransInFrameCountsRiboRPKM
SRR5350740_altENSG00000151892.14ENST00000490345.1GFRA1protein_codingNovel0.004433None2323552677.6848806
Min Ribo Pvalue0.004433
Min TIS PvalueNone
RiboIDCellORTissuePhenotypeRiboSourcePMID
SRR5350740_altMCF7breast adenocarcinomaGSM253888428388414;

Database information
No results
Literature information
No results
Mass Spectrometry Information
No results
Function and Disease
Functional domain prediction Funtion   
AnalysisSignature AccessionSignature DescriptionStart locationStop locationScoreStatus of the matchInterPro accessionInterPro descriptionGOPathways
MobiDBLitemobidb-liteconsensus disorder prediction2141-T
DiseaseDetected
No results
Related Variants
VarIDConsequence To sORFrsIDRiboID
10-116272107-G-ANon-Synonymous p.T7Mrs2577360SRR2818787;SRR3208885;SRR3208921;SRR5047770;SRR5350740;SRR5990809;SRR5990810;SRR5990811;SRR6838651;SRR8310197;SRR8310201;SRR8310198;SRR8310199;SRR8310200;SRR8310205;SRR810100;SRR810101;SRR1795427
Related Small Proteins with Different TISs
IDSmall Protein LengthStart CodonStrandBlocks
SPROHSA25902934CTG-116272003-116272105
SPROHSA26047971CTG-116272003-116272216