Specific Information of Small Protein : SPROHSA260480
General Information
Small Protein IDSPROHSA260480
Organismhuman (Homo sapiens)
Small Protein SequenceLSRRRRWLLPDPEFPLSLDGAELWAARAAQLSGDRCTLSSLGKTQRRLGIFLGGRGPAPRRHHVPGDPVLRAAALGLAPVGRSERRRPPGLRESQ*
RNA SequenceCTGAGTCGCCGGCGGCGGTGGCTGCTGCCAGACCCGGAGTTTCCTCTTTCACTGGATGGAGCTGAACTTTGGGCGGCCAGAGCAGCACAGCTGTCCGGGGATCGCTGCACGCTGAGCTCCCTCGGCAAGACCCAGCGGCGGCTCGGGATTTTTTTGGGGGGGCGGGGACCAGCCCCGCGCCGGCACCATGTTCCTGGCGACCCTGTACTTCGCGCTGCCGCTCTTGGACTTGCTCCTGTCGGCCGAAGTGAGCGGCGGAGACCGCCTGGATTGCGTGAAAGCCAGTGA
Protein Length95
Start CodonCTG
Locationchr10:116271054-116272216:-
Blocks116271054-116271115,116271989-116272216
Mean PhyloCSF-3.19230250182
Data SourceRibosome profiling;
Related GenesENSG00000151892; GFRA1;
Mass (Da)mono. 10429.7; avg. 10435.9
Ribosome profiling
RiboIDGeneIDTransIDSymbolGeneTypeTISTypeRiboPvalueTISPvalueStartOnTransStopOnTransInFrameCountsRiboRPKM
GSE45785_1_altENSG00000151892.14ENST00000439649.7GFRA1protein_coding5'UTR0.023883None181469818.2111148
GSE45785_1_altENSG00000151892.14ENST00000369234.4GFRA1protein_coding5'UTR0.023883None225513818.2111148
GSE45785_1_altENSG00000151892.14ENST00000355422.10GFRA1protein_coding5'UTR0.023883None364652818.2111148
GSE45785_1_altENSG00000151892.14ENST00000369236.5GFRA1protein_coding5'UTR0.023883None66354818.2111148
Min Ribo Pvalue0.023883
Min TIS PvalueNone
RiboIDCellORTissuePhenotypeRiboSourcePMID
GSE45785_1_altBJ cellsWTGSM111520423594524;

Database information
No results
Literature information
No results
Mass Spectrometry Information
No results
Function and Disease
Functional domain prediction Funtion   
AnalysisSignature AccessionSignature DescriptionStart locationStop locationScoreStatus of the matchInterPro accessionInterPro descriptionGOPathways
No results
DiseaseDetected
No results
Related Variants
VarIDConsequence To sORFrsIDRiboID
10-116272107-G-ANon-Synonymous p.T37Mrs2577360SRR2818787;SRR3208885;SRR3208921;SRR5047770;SRR5350740;SRR5990809;SRR5990810;SRR5990811;SRR6838651;SRR8310197;SRR8310201;SRR8310198;SRR8310199;SRR8310200;SRR8310205;SRR810100;SRR810101;SRR1795427
Related Small Proteins with Different TISs
IDSmall Protein LengthStart CodonStrandBlocks
SPROHSA12159298ATC-116271054-116271115,116271989-116272225