Specific Information of Small Protein : SPROHSA121592
General Information
Small Protein IDSPROHSA121592
Organismhuman (Homo sapiens)
Small Protein SequenceIPELSRRRRWLLPDPEFPLSLDGAELWAARAAQLSGDRCTLSSLGKTQRRLGIFLGGRGPAPRRHHVPGDPVLRAAALGLAPVGRSERRRPPGLRESQ*
RNA SequenceATCCCGGAGCTGAGTCGCCGGCGGCGGTGGCTGCTGCCAGACCCGGAGTTTCCTCTTTCACTGGATGGAGCTGAACTTTGGGCGGCCAGAGCAGCACAGCTGTCCGGGGATCGCTGCACGCTGAGCTCCCTCGGCAAGACCCAGCGGCGGCTCGGGATTTTTTTGGGGGGGCGGGGACCAGCCCCGCGCCGGCACCATGTTCCTGGCGACCCTGTACTTCGCGCTGCCGCTCTTGGACTTGCTCCTGTCGGCCGAAGTGAGCGGCGGAGACCGCCTGGATTGCGTGAAAGCCAGTGA
Protein Length98
Start CodonATC
Locationchr10:116271054-116272225:-
Blocks116271054-116271115,116271989-116272225
Mean PhyloCSF-3.26946087998
Data SourceRibosome profiling;
Related GenesENSG00000151892; GFRA1;
Mass (Da)mono. 10768.9; avg. 10775.3
Ribosome profiling
RiboIDGeneIDTransIDSymbolGeneTypeTISTypeRiboPvalueTISPvalueStartOnTransStopOnTransInFrameCountsRiboRPKM
SRR5350740_altENSG00000151892.14ENST00000439649.7GFRA1protein_coding5'UTR0.003424None17246985105.179412
SRR5350740_altENSG00000151892.14ENST00000355422.10GFRA1protein_coding5'UTR0.003424None35565285105.179412
SRR5350740_altENSG00000151892.14ENST00000369236.5GFRA1protein_coding5'UTR0.003424None5735485105.179412
Min Ribo Pvalue0.003424
Min TIS PvalueNone
RiboIDCellORTissuePhenotypeRiboSourcePMID
SRR5350740_altMCF7breast adenocarcinomaGSM253888428388414;

Database information
No results
Literature information
No results
Mass Spectrometry Information
No results
Function and Disease
Functional domain prediction Funtion   
AnalysisSignature AccessionSignature DescriptionStart locationStop locationScoreStatus of the matchInterPro accessionInterPro descriptionGOPathways
No results
DiseaseDetected
No results
Related Variants
VarIDConsequence To sORFrsIDRiboID
10-116272107-G-ANon-Synonymous p.T40Mrs2577360SRR2818787;SRR3208885;SRR3208921;SRR5047770;SRR5350740;SRR5990809;SRR5990810;SRR5990811;SRR6838651;SRR8310197;SRR8310201;SRR8310198;SRR8310199;SRR8310200;SRR8310205;SRR810100;SRR810101;SRR1795427
Related Small Proteins with Different TISs
IDSmall Protein LengthStart CodonStrandBlocks
SPROHSA26048095CTG-116271054-116271115,116271989-116272216