Specific Information of Small Protein : SPROHSA251745
General Information
Small Protein ID | SPROHSA251745 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | LNFGRPEQHSCPGIAAR* |
RNA Sequence | CTGAACTTTGGGCGGCCAGAGCAGCACAGCTGTCCGGGGATCGCTGCACGCTGA |
Protein Length | 17 |
Start Codon | CTG |
Location | chr10:116272101-116272155:- |
Blocks | 116272101-116272155 |
Mean PhyloCSF | -3.62211106994 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000151892; GFRA1; |
Mass (Da) | mono. 1851.9; avg. 1853.1 |
Ribosome profiling
Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
---|
SRR3208921_alt | ENSG00000151892.14 | ENST00000369236.5 | GFRA1 | Protein_coding | 5'UTR | 0.00669 | None | 127 | 181 | 17 | 69.9783794 |
SRR3208921_alt | ENSG00000151892.14 | ENST00000490345.1 | GFRA1 | Protein_coding | Novel | 0.00669 | None | 203 | 257 | 17 | 69.9783794 |
SRR3208921_alt | ENSG00000151892.14 | ENST00000439649.7 | GFRA1 | Protein_coding | 5'UTR | 0.00669 | None | 242 | 296 | 17 | 69.9783794 |
SRR3208921_alt | ENSG00000151892.14 | ENST00000369234.4 | GFRA1 | Protein_coding | 5'UTR | 0.00669 | None | 286 | 340 | 17 | 69.9783794 |
SRR3208921_alt | ENSG00000151892.14 | ENST00000355422.10 | GFRA1 | Protein_coding | 5'UTR | 0.00669 | None | 425 | 479 | 17 | 69.9783794 |
Min Ribo P value | 0.00669 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
SRR3208921_alt | ES cell-derived neurons TSC2-/- | Tuberous sclerosis complex | GSM2082573 | 27655340; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |       |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
Tuberous sclerosis complex | Predicted by Ribo-seq |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
10-116272107-G-A | Non-Synonymous p.R17C | rs2577360 | SRR2818787; SRR3208885; SRR3208921; SRR5047770; SRR5350740; SRR5990809; SRR5990810; SRR5990811; SRR6838651; SRR8310197; SRR8310201; SRR8310198; SRR8310199; SRR8310200; SRR8310205; SRR810100; SRR810101; SRR1795427 |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
SPROHSA186468 | 19 | ATG | - | 116272101-116272161 |