Specific Information of Small Protein : SPROHSA251745
General Information
Small Protein IDSPROHSA251745
Organismhuman (Homo sapiens)
Small Protein SequenceLNFGRPEQHSCPGIAAR*
RNA SequenceCTGAACTTTGGGCGGCCAGAGCAGCACAGCTGTCCGGGGATCGCTGCACGCTGA
Protein Length17
Start CodonCTG
Locationchr10:116272101-116272155:-
Blocks116272101-116272155
Mean PhyloCSF-3.62211106994
Data SourceRibosome profiling;
Related GenesENSG00000151892; GFRA1;
Mass (Da)mono. 1851.9; avg. 1853.1
Ribosome profiling
RiboIDGeneIDTransIDSymbolGeneTypeTISTypeRiboPvalueTISPvalueStartOnTransStopOnTransInFrameCountsRiboRPKM
SRR3208921_altENSG00000151892.14ENST00000369236.5GFRA1protein_coding5'UTR0.00669None1271811769.9783794
SRR3208921_altENSG00000151892.14ENST00000490345.1GFRA1protein_codingNovel0.00669None2032571769.9783794
SRR3208921_altENSG00000151892.14ENST00000439649.7GFRA1protein_coding5'UTR0.00669None2422961769.9783794
SRR3208921_altENSG00000151892.14ENST00000369234.4GFRA1protein_coding5'UTR0.00669None2863401769.9783794
SRR3208921_altENSG00000151892.14ENST00000355422.10GFRA1protein_coding5'UTR0.00669None4254791769.9783794
Min Ribo Pvalue0.00669
Min TIS PvalueNone
RiboIDCellORTissuePhenotypeRiboSourcePMID
SRR3208921_altES cell-derived neurons TSC2-/-Tuberous sclerosis complexGSM208257327655340;

Database information
No results
Literature information
No results
Mass Spectrometry Information
No results
Function and Disease
Functional domain prediction Funtion   
AnalysisSignature AccessionSignature DescriptionStart locationStop locationScoreStatus of the matchInterPro accessionInterPro descriptionGOPathways
No results
DiseaseDetected
tuberous sclerosis complexPredictedByRibo
Related Variants
VarIDConsequence To sORFrsIDRiboID
10-116272107-G-ANon-Synonymous p.R17Crs2577360SRR2818787;SRR3208885;SRR3208921;SRR5047770;SRR5350740;SRR5990809;SRR5990810;SRR5990811;SRR6838651;SRR8310197;SRR8310201;SRR8310198;SRR8310199;SRR8310200;SRR8310205;SRR810100;SRR810101;SRR1795427
Related Small Proteins with Different TISs
IDSmall Protein LengthStart CodonStrandBlocks
SPROHSA18646819ATG-116272101-116272161