Specific Information of Small Protein : SPROHSA186468
General Information
Small Protein IDSPROHSA186468
Organismhuman (Homo sapiens)
Small Protein SequenceMELNFGRPEQHSCPGIAAR*
RNA SequenceATGGAGCTGAACTTTGGGCGGCCAGAGCAGCACAGCTGTCCGGGGATCGCTGCACGCTGA
Protein Length19
Start CodonATG
Locationchr10:116272101-116272161:-
Blocks116272101-116272161
Mean PhyloCSF-3.60233329237
Data SourceRibosome profiling; Literature;
Related GenesENSG00000151892; GFRA1;
Mass (Da)mono. 2112; avg. 2113.4
Ribosome profiling
RiboIDGeneIDTransIDSymbolGeneTypeTISTypeRiboPvalueTISPvalueStartOnTransStopOnTransInFrameCountsRiboRPKM
SRR3208885ENSG00000151892.14ENST00000369236.5GFRA1protein_coding5'UTR0.030288None12118141122.768443
SRR3208885_altENSG00000151892.14ENST00000369236.5GFRA1protein_coding5'UTR0.030288None12118141122.768443
SRR3208921ENSG00000151892.14ENST00000369236.5GFRA1protein_coding5'UTR0.007169None1211811970.3900170
GSE94454ENSG00000151892.14ENST00000369236.5GFRA1protein_coding5'UTR0.048388None121181118.16120934
GSE94454_altENSG00000151892.14ENST00000369236.5GFRA1protein_coding5'UTR0.048388None121181118.16120934
SRR3208885ENSG00000151892.14ENST00000490345.1GFRA1protein_codingNovel0.030288None19725741122.768443
SRR3208885_altENSG00000151892.14ENST00000490345.1GFRA1protein_codingNovel0.030288None19725741122.768443
SRR3208921ENSG00000151892.14ENST00000490345.1GFRA1protein_codingNovel0.007169None1972571970.3900170
GSE94454ENSG00000151892.14ENST00000490345.1GFRA1protein_codingNovel0.048388None197257118.16120934
GSE94454_altENSG00000151892.14ENST00000490345.1GFRA1protein_codingNovel0.048388None197257118.16120934
SRR3208885ENSG00000151892.14ENST00000439649.7GFRA1protein_coding5'UTR0.030288None23629641122.768443
SRR3208885_altENSG00000151892.14ENST00000439649.7GFRA1protein_coding5'UTR0.030288None23629641122.768443
SRR3208921ENSG00000151892.14ENST00000439649.7GFRA1protein_coding5'UTR0.007169None2362961970.3900170
GSE94454ENSG00000151892.14ENST00000439649.7GFRA1protein_coding5'UTR0.048388None236296118.16120934
GSE94454_altENSG00000151892.14ENST00000439649.7GFRA1protein_coding5'UTR0.048388None236296118.16120934
SRR3208885ENSG00000151892.14ENST00000369234.4GFRA1protein_coding5'UTR0.030288None28034041122.768443
SRR3208885_altENSG00000151892.14ENST00000369234.4GFRA1protein_coding5'UTR0.030288None28034041122.768443
SRR3208921ENSG00000151892.14ENST00000369234.4GFRA1protein_coding5'UTR0.007169None2803401970.3900170
GSE94454ENSG00000151892.14ENST00000369234.4GFRA1protein_coding5'UTR0.048388None280340118.16120934
GSE94454_altENSG00000151892.14ENST00000369234.4GFRA1protein_coding5'UTR0.048388None280340118.16120934
SRR3208885ENSG00000151892.14ENST00000355422.10GFRA1protein_coding5'UTR0.030288None41947941122.768443
SRR3208885_altENSG00000151892.14ENST00000355422.10GFRA1protein_coding5'UTR0.030288None41947941122.768443
SRR3208921ENSG00000151892.14ENST00000355422.10GFRA1protein_coding5'UTR0.007169None4194791970.3900170
GSE94454ENSG00000151892.14ENST00000355422.10GFRA1protein_coding5'UTR0.048388None419479118.16120934
GSE94454_altENSG00000151892.14ENST00000355422.10GFRA1protein_coding5'UTR0.048388None419479118.16120934
Min Ribo Pvalue0.007169
Min TIS PvalueNone
RiboIDCellORTissuePhenotypeRiboSourcePMID
GSE94454Huh7hepatomaGSM2476003;GSM2476004;GSM247600528323820;
GSE94454_altHuh7hepatomaGSM2476003;GSM2476004;GSM247600528323820;
SRR3208885ES cell-derived neurons TSC2+/+WTGSM208253727655340;
SRR3208885_altES cell-derived neurons TSC2+/+WTGSM208253727655340;
SRR3208921ES cell-derived neurons TSC2-/-Tuberous sclerosis complexGSM208257327655340;

Database information
No results
Literature information
PMID26687005;
Cell lines Or TissuesBJ
PhenotypeNULL
Gene IDENSG00000151892
Transcript IDENST00000490345
SymbolNA
ORF TypesORF
Gene Typeprotein_coding
ThroughputHigh-throughput Literature Mining
InteractionNA
Function DescriptionNA
Mass Spectrometry Information
No results
Function and Disease
Functional domain prediction Funtion   
AnalysisSignature AccessionSignature DescriptionStart locationStop locationScoreStatus of the matchInterPro accessionInterPro descriptionGOPathways
No results
DiseaseDetected
tuberous sclerosis complexPredictedByRibo
Related Variants
VarIDConsequence To sORFrsIDRiboID
10-116272107-G-ANon-Synonymous p.R19Crs2577360SRR2818787;SRR3208885;SRR3208921;SRR5047770;SRR5350740;SRR5990809;SRR5990810;SRR5990811;SRR6838651;SRR8310197;SRR8310201;SRR8310198;SRR8310199;SRR8310200;SRR8310205;SRR810100;SRR810101;SRR1795427
Related Small Proteins with Different TISs
IDSmall Protein LengthStart CodonStrandBlocks
SPROHSA25174517CTG-116272101-116272155