Loading...
| piRBase Id | piR-mmu-986 | Accession | DQ549740 |
|---|---|---|---|
| Organism | Mouse | Number of methods | 4 |
| Sequence | TGCCAAGTGTATGAGTGAGAATAGAG | Number of papers | 11 |
| Length | 26 | Golden piRNA | Y |
| Aliases | piR-17852; PIR10851; | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 4 | N/A | N/A | 16751776 | small RNA | testis |
| 35 | GSM684620 | 2 | 22842725 | Mili CLIP | C57BL/6 adult testis |
| 51 | GSM610966 | 2 | 21602304 | small RNA | Male germ cell, Pachytene spermatocytes |
| 64 | GSM319960 | 1 | 18922463 | small RNA | 10 dpp testis |
| 66 | GSM509275 | 1 | 20439430 | small RNA | MitoPLD+/+ E16.5 testis |
| 121 | GSM545783 | 15 | 20534472 | Mov10L1 IP | wild type adult testis |
| 126 | GSM466728 | 2 | 20059948 | Mili IP | Tdrd9+/- 14dpp testis |
| 129 | GSM466729 | 12 | 20059948 | Mili IP | Tdrd9+/- 14dpp testis |
| 132 | GSM475279 | 4 | 20022248 | Miwi IP | adult testis |
| 133 | GSM475280 | 125 | 20022248 | Mili IP | adult testis |
| 225 | GSM1528807 | 41 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
| 226 | GSM1528808 | 28 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
| 227 | GSM1528809 | 37 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
| 228 | GSM1528810 | 42 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
| 234 | GSM433288 | 10 | 26115953 | small RNA | 18dpp hetero tdrd6 KO testes |
| 235 | GSM433289 | 18 | 26115953 | small RNA | 18dpp homo tdrd6 KO testes |
| 236 | GSM433290 | 9 | 26115953 | small RNA | 25dpp hetero tdrd6 KO testes |
| 237 | GSM433291 | 4 | 26115953 | small RNA | 25dpp homo tdrd6 KO testes |
| 345 | GSM475279 | 4 | 20022248 | Miwi-IP | testis |
| 346 | GSM475280 | 125 | 20022248 | Mili-IP | testis |
| 347 | GSM475281 | 11 | 20022248 | small RNA | testis |
| 441 | GSM1096582 | 8 | 23523368 | small RNA | Wild Type 10.5 dpp testes |
| 443 | GSM1096583 | 98 | 23523368 | small RNA | Wild Type 12.5 dpp testes |
| 444 | GSM1096600 | 76 | 23523368 | oxidized small RNA | Wild Type 12.5 dpp testes |
| 445 | GSM1096584 | 153 | 23523368 | small RNA | Wild Type 14.5 dpp testes |
| 446 | GSM1096601 | 182 | 23523368 | oxidized small RNA | Wild Type 14.5 dpp testes |
| 447 | GSM1096585 | 13 | 23523368 | small RNA | Wild Type 17.5 dpp testes |
| 448 | GSM1096602 | 4 | 23523368 | oxidized small RNA | Wild Type 17.5 dpp testes |
| 449 | GSM1096586 | 15 | 23523368 | small RNA | Wild Type 20.5 dpp testes |
| 450 | GSM1096603 | 20 | 23523368 | oxidized small RNA | Wild Type 20.5 dpp testes |
| 451 | GSM1096587 | 11 | 23523368 | small RNA | Wild Type 6 weeks dpp testes |
| 452 | GSM1096604 | 2 | 23523368 | oxidized small RNA | Wild Type 6 weeks dpp testes |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 15:74643301-74643327:+ |
| Sample | CPM |
|---|---|
| GSM179088 | 0 |
| GSM261957 | 0 |
| GSM261958 | 0 |
| GSM261959 | 0 |
| GSM319953 | 0 |
| GSM319954 | 0 |
| GSM319955 | 0 |
| GSM319956 | 0 |
| GSM319957 | 0 |
| GSM319958 | 0 |
| GSM319959 | 0 |
| GSM319960 | 0.4991 |
| GSM319961 | 0 |
| GSM400967 | 5.592 |
| Sample | CPM |
|---|---|
| GSM400968 | 14.0683 |
| GSM400969 | 0 |
| GSM433288 | 2.3419 |
| GSM433289 | 3.9373 |
| GSM433290 | 1.9114 |
| GSM433291 | 1.4229 |
| GSM433292 | 1.2156 |
| GSM433293 | 1.7015 |
| GSM433294 | 0 |
| GSM433295 | 0 |
| GSM475279 | 0.3842 |
| GSM475280 | 11.365 |
| GSM475281 | 1.0319 |
| GSM678422 | 0 |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
|---|---|---|---|
| Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
| Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. | ||
| PubMed | 22842725 | Journal | Nat Struct Mol Biol. 2012 Aug;19(8):773-81. |
|---|---|---|---|
| Title | Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis. | ||
| Authors | Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z. | ||
| PubMed | 21602304 | Journal | RNA. 2011 Jul;17(7):1191-203. |
|---|---|---|---|
| Title | piRNA profiling during specific stages of mouse spermatogenesis. | ||
| Authors | Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C. | ||
| PubMed | 18922463 | Journal | Mol Cell. 2008 Sep 26;31(6):785-99. |
|---|---|---|---|
| Title | A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice. | ||
| Authors | Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ. | ||
| PubMed | 20439430 | Journal | Genes Dev. 2010 May;24(9):887-92. |
|---|---|---|---|
| Title | MVH in piRNA processing and gene silencing of retrotransposons. | ||
| Authors | Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T. | ||
| PubMed | 20534472 | Journal | Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6. |
|---|---|---|---|
| Title | Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway. | ||
| Authors | Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ. | ||
| PubMed | 20059948 | Journal | Dev Cell. 2009 Dec;17(6):775-87. |
|---|---|---|---|
| Title | The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline. | ||
| Authors | Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S. | ||
| PubMed | 20022248 | Journal | Curr Biol. 2009 Dec 29;19(24):2066-76. |
|---|---|---|---|
| Title | A broadly conserved pathway generates 3'UTR-directed primary piRNAs. | ||
| Authors | Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC. | ||
| PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
|---|---|---|---|
| Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
| Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. | ||
| PubMed | 26115953 | Journal | Genes Dev. 2015 Jul 1; 29(13): 1403?415 |
|---|---|---|---|
| Title | RNF17 blocks promiscuous activity of PIWI proteins in mouse testes | ||
| Authors | Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ | ||
| PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
|---|---|---|---|
| Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
| Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. | ||