Loading...

Detail Information of piRNA: piR-mmu-9822

General Information
piRBase Id piR-mmu-9822 Accession N/A
Organism Mouse Number of methods 4
Sequence TTTGATCCTGACACAGAGATGCGACC Number of papers 13
Length 26 Golden piRNA Y
Aliases PIR188676;
Datasets
Dataset Accession Reads PubMed Method Tissue
5 N/A N/A 16751777 MILI IP testis
11 GSM822760 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
13 GSM822759 1 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 7 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
50 GSM610965 2 21602304 small RNA Male germ cell, Type A spermatogonia
51 GSM610966 1128 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 157 21602304 small RNA Male germ cell, Round spermatids
65 GSM319961 1 18922463 small RNA 10 dpp MILI KO testis
66 GSM509275 1 20439430 small RNA MitoPLD+/+ E16.5 testis
68 GSM509277 2 20439430 small RNA Mili-/- E16.5 testis
72 GSM179088 1 17446352 Mili IP 10 dpp testis
121 GSM545783 11 20534472 Mov10L1 IP wild type adult testis
126 GSM466728 34 20059948 Mili IP Tdrd9+/- 14dpp testis
129 GSM466729 27 20059948 Mili IP Tdrd9+/- 14dpp testis
132 GSM475279 9 20022248 Miwi IP adult testis
133 GSM475280 61 20022248 Mili IP adult testis
217 GSM1653802 2 25582079 MIWI CLIP round spermatids
224 GSM1528806 28 26588211 small RNA 10dpp testes
225 GSM1528807 24 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 34 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 90 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 80 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 24 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 70 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 50 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 6 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 9 20022248 Miwi-IP testis 
346 GSM475280 61 20022248 Mili-IP testis 
347 GSM475281 10 20022248 small RNA testis 
441 GSM1096582 19 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 584 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 106 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 373 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 123 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 18 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 12 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 64 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 70 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 39 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 22 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 17:27359271-27359297:+ Gm49794 ENSMUST00000232133; Simple_repeat Simple_repeat (TC)n;
piRNA Expression
Sample CPM
GSM179088 5.5319
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 2.0518
GSM400967 6.524
Sample CPM
GSM400968 17.1946
GSM400969 1.6721
GSM433288 5.6205
GSM433289 15.3119
GSM433290 10.6187
GSM433291 2.1344
GSM433292 5.5919
GSM433293 7.6569
GSM433294 0
GSM433295 0
GSM475279 0.8645
GSM475280 5.5461
GSM475281 0.9381
GSM678422 0
The Expression of piRNA: piR-mmu-9822
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751777 Journal Nature. 2006 Jul 13;442(7099):203-7.
Title A novel class of small RNAs bind to MILI protein in mouse testes
Authors Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 17446352 Journal Science. 2007 May 4;316(5825):744-7.
Title Developmentally regulated piRNA clusters implicate MILI in transposon control.
Authors Aravin AA, Sachidanandam R, Girard A, Fejes-Toth K, Hannon GJ.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.