Loading...

Detail Information of piRNA: piR-mmu-953

General Information
piRBase Id piR-mmu-953 Accession DQ718500
Organism Mouse Number of methods 4
Sequence TGCCAAGGAAGTTTTTACTGTCTTAGCCTC Number of papers 6
Length 30 Golden piRNA -
Aliases piR-17822; piR-133822; PIR10821; PIR227148;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
6 GSM113695 1 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
217 GSM1653802 2 25582079 MIWI CLIP round spermatids
225 GSM1528807 161 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 218 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 291 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 302 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 25 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 41 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 61 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 58 26115953 small RNA 25dpp homo tdrd6 KO testes
240 GSM433294 4 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
441 GSM1096582 1 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 10 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 1 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 21 23523368 small RNA Wild Type 14.5 dpp testes
447 GSM1096585 6 23523368 small RNA Wild Type 17.5 dpp testes
449 GSM1096586 14 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 1 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 15 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 2 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
34 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 GL456350.1:81895-81925:-
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 5.8547
GSM433289 8.9684
GSM433290 12.9548
GSM433291 20.6322
GSM433292 14.1014
GSM433293 16.5899
GSM433294 0.9386
GSM433295 0
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-953
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.