Loading...

Detail Information of piRNA: piR-mmu-948

General Information
piRBase Id piR-mmu-948 Accession DQ549706
Organism Mouse Number of methods 4
Sequence TGCCAAGCTCAGGAGAAGCCATTCAACAG Number of papers 9
Length 29 Golden piRNA -
Aliases piR-17818; PIR10817;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
13 GSM822759 5 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 3 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
52 GSM610967 14 21602304 small RNA Male germ cell, Round spermatids
58 GSM319954 1 18922463 Mili IP 10 dpp Dnmt3L KO testis
132 GSM475279 33 20022248 Miwi IP adult testis
133 GSM475280 3 20022248 Mili IP adult testis
217 GSM1653802 16 25582079 MIWI CLIP round spermatids
225 GSM1528807 134 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 88 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 80 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 86 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 11 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 56 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 37 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 10 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 33 20022248 Miwi-IP testis 
346 GSM475280 3 20022248 Mili-IP testis 
347 GSM475281 27 20022248 small RNA testis 
447 GSM1096585 1 23523368 small RNA Wild Type 17.5 dpp testes
449 GSM1096586 7 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 2 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 2 23523368 small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 9:67718836-67718865:- SINE B4 B4A;
piRNA Expression
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 2.5761
GSM433289 12.2495
GSM433290 7.8578
GSM433291 3.5573
GSM433292 7.7801
GSM433293 7.2315
GSM433294 0
GSM433295 0
GSM475279 3.1697
GSM475280 0.2728
GSM475281 2.5329
GSM678422 0
The Expression of piRNA: piR-mmu-948
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.