Loading...

Detail Information of piRNA: piR-mmu-9270

General Information
piRBase Id piR-mmu-9270 Accession DQ557216
Organism Mouse Number of methods 4
Sequence TGTCCTGGATCAGTGGTGCCAAATACTTC Number of papers 8
Length 29 Golden piRNA -
Aliases piR-24328; PIR18327;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
36 GSM684621 48 22842725 Mili CLIP C57BL/6 adult testis
37 GSM684622 1 22842725 Mili CLIP C57BL/6 adult testis
38 GSM684623 37 22842725 Mili CLIP C57BL/6 adult testis
126 GSM466728 2 20059948 Mili IP Tdrd9+/- 14dpp testis
129 GSM466729 1 20059948 Mili IP Tdrd9+/- 14dpp testis
133 GSM475280 3 20022248 Mili IP adult testis
225 GSM1528807 5 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 12 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 10 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 11 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 21 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 12 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 14 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 7 26115953 small RNA 25dpp homo tdrd6 KO testes
346 GSM475280 3 20022248 Mili-IP testis 
347 GSM475281 6 20022248 small RNA testis 
354 GSM4635227 1 33184219 small RNA primordial germ cells(age: E13.5; sex: male)
441 GSM1096582 2 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 11 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 17 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 63 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 24 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 8 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 13 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 11 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 9 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 11 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 6 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 17:27331954-27331983:+ Gm10505 ENSMUST00000232285; Gm10505 ENSMUST00000232497; Gm10505 ENSMUST00000231770; Gm10505 ENSMUST00000231262; Gm10505 ENSMUST00000232363; Gm10505 ENSMUST00000231707; Gm10505 ENSMUST00000232070; Gm10505 ENSMUST00000231462; Gm10505 ENSMUST00000232675; Gm10505 ENSMUST00000231336; Gm10505 ENSMUST00000232171; Gm10505 ENSMUST00000231637; Gm10505 ENSMUST00000232125;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0.3107
Sample CPM
GSM400968 0.3908
GSM400969 0
GSM433288 4.918
GSM433289 2.6249
GSM433290 2.9732
GSM433291 2.4901
GSM433292 5.8351
GSM433293 3.403
GSM433294 0
GSM433295 0
GSM475279 0
GSM475280 0.2728
GSM475281 0.5629
GSM678422 0
The Expression of piRNA: piR-mmu-9270
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 33184219 Journal Genes Dev. 2020 Dec 1;34(23-24):1637-1649. doi: 10.1101/gad.341602.120. Epub 2020 Nov 12.
Title Sexually dimorphic DNA damage responses and mutation avoidance in the mouse germline.
Authors Bloom JC, Schimenti JC.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.